Incidental Mutation 'R0462:Zfp90'
Institutional Source Beutler Lab
Gene Symbol Zfp90
Ensembl Gene ENSMUSG00000031907
Gene Namezinc finger protein 90
SynonymsKRAB17, Zfp83, NK10, Nk10 expressed protein, 6430515L01Rik, Zfp64
MMRRC Submission 038662-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.139) question?
Stock #R0462 (G1)
Quality Score225
Status Not validated
Chromosomal Location106415327-106426598 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 106425260 bp
Amino Acid Change Serine to Leucine at position 535 (S535L)
Ref Sequence ENSEMBL: ENSMUSP00000148744 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034382] [ENSMUST00000212606] [ENSMUST00000212874] [ENSMUST00000213045]
Predicted Effect possibly damaging
Transcript: ENSMUST00000034382
AA Change: S535L

PolyPhen 2 Score 0.890 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000034382
Gene: ENSMUSG00000031907
AA Change: S535L

KRAB 14 74 4.83e-40 SMART
ZnF_C2H2 208 230 1.38e-3 SMART
ZnF_C2H2 250 272 2.75e-3 SMART
ZnF_C2H2 278 300 3.83e-2 SMART
ZnF_C2H2 306 328 1.13e-4 SMART
ZnF_C2H2 334 356 2.09e-3 SMART
ZnF_C2H2 362 384 3.16e-3 SMART
ZnF_C2H2 390 412 1.6e-4 SMART
ZnF_C2H2 446 468 1.92e-2 SMART
ZnF_C2H2 494 516 3.69e-4 SMART
ZnF_C2H2 522 544 5.59e-4 SMART
ZnF_C2H2 550 572 1.28e-3 SMART
ZnF_C2H2 578 600 1.28e-3 SMART
ZnF_C2H2 606 628 2.4e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180410
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211958
Predicted Effect probably benign
Transcript: ENSMUST00000212606
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212866
Predicted Effect possibly damaging
Transcript: ENSMUST00000212874
AA Change: S535L

PolyPhen 2 Score 0.890 (Sensitivity: 0.82; Specificity: 0.94)
Predicted Effect probably benign
Transcript: ENSMUST00000213045
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the zinc finger protein family that modulates gene expression. The encoded protein derepresses the transcription of certain fetal cardiac genes and may contribute to the genetic reprogramming that occurs during the development of heart failure. Genome wide association studies have identified this gene among ulcerative colitis risk loci. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Mar 2015]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700016D06Rik T A 8: 11,661,749 probably benign Het
1700022I11Rik T A 4: 42,973,429 F921I probably benign Het
9530053A07Rik A T 7: 28,137,340 D228V probably damaging Het
Aarsd1 A T 11: 101,414,091 D190E probably damaging Het
Acnat2 A G 4: 49,383,084 probably null Het
Acot10 T G 15: 20,666,626 T10P possibly damaging Het
Aldh7a1 T C 18: 56,534,214 probably null Het
Alkbh7 G A 17: 56,998,443 V87I probably benign Het
Ano2 A T 6: 125,712,275 H121L probably benign Het
Apob A T 12: 8,000,896 Y1040F probably damaging Het
Arhgap25 A T 6: 87,459,960 V636E possibly damaging Het
Atad2b A T 12: 4,941,973 T191S possibly damaging Het
Btbd9 A T 17: 30,530,217 V41D possibly damaging Het
Bzw2 G A 12: 36,124,024 R25C probably damaging Het
Carmil1 T C 13: 24,022,511 S1326G probably benign Het
Cdh18 A G 15: 23,366,885 R226G probably damaging Het
Cdh3 A G 8: 106,555,380 N800S possibly damaging Het
Cep152 A T 2: 125,583,934 V837E possibly damaging Het
Cep85 G A 4: 134,131,421 T713M possibly damaging Het
Chd7 T C 4: 8,850,821 Y1736H probably damaging Het
Chst3 T C 10: 60,186,713 E104G probably benign Het
Cic T A 7: 25,287,140 S1299T probably damaging Het
Cic C A 7: 25,287,141 S1299Y probably damaging Het
Cmah T A 13: 24,436,741 S319R possibly damaging Het
Cnbd1 A G 4: 18,895,044 F233L probably benign Het
Cpne5 T C 17: 29,176,189 E251G probably benign Het
Csf2rb2 G A 15: 78,285,173 P485L probably damaging Het
Dimt1 T C 13: 106,948,756 M70T possibly damaging Het
Dlk2 A G 17: 46,303,098 *383W probably null Het
Dnah2 G A 11: 69,459,201 R2369C probably damaging Het
Dock2 A G 11: 34,268,052 F1173L possibly damaging Het
Dok7 A G 5: 35,066,462 H115R possibly damaging Het
Dpy19l1 A G 9: 24,414,349 I720T probably benign Het
Eps8 A T 6: 137,514,311 D356E probably benign Het
Exoc1 A G 5: 76,543,617 N263D probably benign Het
Fam173b T C 15: 31,616,872 M161T probably damaging Het
Fbxl3 T C 14: 103,082,886 D375G probably damaging Het
Flg2 A T 3: 93,201,437 E257D probably benign Het
Fstl4 A G 11: 53,186,402 D662G probably benign Het
Gbp10 G T 5: 105,218,524 Q505K possibly damaging Het
Gemin2 C T 12: 59,013,519 P15S probably damaging Het
Gm14124 A G 2: 150,269,202 E604G possibly damaging Het
Grhl2 A G 15: 37,344,675 M514V probably benign Het
Hgs A G 11: 120,479,144 N413D possibly damaging Het
Il12rb2 T C 6: 67,303,610 S538G possibly damaging Het
Kdm5a A G 6: 120,402,600 D623G probably damaging Het
Kif1bp A T 10: 62,559,456 I469N probably damaging Het
Matk G T 10: 81,259,693 V116F probably damaging Het
Mcm3 T C 1: 20,805,332 T694A probably benign Het
Mctp1 C A 13: 76,801,401 H260Q probably damaging Het
Mios T A 6: 8,215,743 I313K probably benign Het
Muc4 T A 16: 32,762,536 Y2562N possibly damaging Het
Naip5 T A 13: 100,221,732 I999F probably damaging Het
Olfr128 A T 17: 37,923,776 D70V probably damaging Het
Olfr1375 A G 11: 51,048,509 Y134C probably damaging Het
Olfr68 A T 7: 103,777,563 S261T probably benign Het
Olfr749 T A 14: 50,737,097 I22L probably benign Het
Olfr834 A T 9: 18,988,902 I305F probably benign Het
Olfr965 T A 9: 39,719,410 F61Y probably benign Het
Pafah1b1 A G 11: 74,677,715 V396A probably benign Het
Pard6b T A 2: 168,087,547 I91N possibly damaging Het
Pdzd2 T C 15: 12,592,160 S133G probably damaging Het
Plcg2 T G 8: 117,585,305 S445R probably benign Het
Plekhd1 G T 12: 80,721,578 V396L probably damaging Het
Ppp4r2 A G 6: 100,866,557 D294G possibly damaging Het
Ppwd1 T C 13: 104,222,960 probably null Het
Prr22 A G 17: 56,770,551 probably benign Het
Psme4 A G 11: 30,848,117 D1370G probably damaging Het
Rac3 T A 11: 120,722,858 V86D probably damaging Het
Rnf207 T C 4: 152,313,372 S335G possibly damaging Het
Rxfp3 A G 15: 11,036,977 L103P probably damaging Het
Slc17a3 C T 13: 23,855,858 S293F probably damaging Het
Smpdl3a G T 10: 57,794,731 C17F probably benign Het
Spen A T 4: 141,473,651 I2555N probably damaging Het
Srpk2 G T 5: 23,518,426 T564K probably damaging Het
Stard4 C T 18: 33,205,149 R116H probably damaging Het
Supt7l A T 5: 31,520,296 S175R probably damaging Het
Sycp1 A T 3: 102,819,106 Y932N possibly damaging Het
Tas2r122 T C 6: 132,711,178 M251V probably benign Het
Tbx15 A T 3: 99,316,318 E274V probably damaging Het
Tex52 A G 6: 128,384,954 E298G probably benign Het
Tmem101 T C 11: 102,155,867 M59V probably benign Het
Tmem132b T C 5: 125,785,926 V665A probably damaging Het
Trim23 T C 13: 104,198,033 V347A probably damaging Het
Ush2a A G 1: 188,910,939 H4166R probably benign Het
Vmn2r101 G T 17: 19,590,169 V406L probably benign Het
Vrk3 A G 7: 44,764,200 D166G possibly damaging Het
Washc4 T A 10: 83,556,913 M259K probably benign Het
Wdr70 T C 15: 8,079,161 D167G probably benign Het
Zfp28 A T 7: 6,392,240 Q248L possibly damaging Het
Zfp39 A G 11: 58,890,406 I510T probably benign Het
Zfp710 T A 7: 80,090,341 *646R probably null Het
Zfp949 C T 9: 88,568,734 T119I possibly damaging Het
Other mutations in Zfp90
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01753:Zfp90 APN 8 106424150 missense probably benign 0.00
IGL02170:Zfp90 APN 8 106419524 missense probably damaging 0.99
IGL02818:Zfp90 APN 8 106424209 missense probably benign
R0378:Zfp90 UTSW 8 106425506 missense possibly damaging 0.69
R1555:Zfp90 UTSW 8 106424095 missense probably benign
R1869:Zfp90 UTSW 8 106419123 missense probably benign 0.00
R1870:Zfp90 UTSW 8 106419123 missense probably benign 0.00
R2110:Zfp90 UTSW 8 106425488 missense probably damaging 1.00
R2112:Zfp90 UTSW 8 106425488 missense probably damaging 1.00
R3717:Zfp90 UTSW 8 106424050 missense probably benign 0.12
R4506:Zfp90 UTSW 8 106424864 missense possibly damaging 0.78
R5288:Zfp90 UTSW 8 106425368 missense probably damaging 1.00
R5691:Zfp90 UTSW 8 106425078 nonsense probably null
R5789:Zfp90 UTSW 8 106423973 missense probably benign
R6283:Zfp90 UTSW 8 106425394 missense probably damaging 1.00
R6560:Zfp90 UTSW 8 106415747 missense probably damaging 0.99
R6977:Zfp90 UTSW 8 106425316 missense probably damaging 1.00
R6977:Zfp90 UTSW 8 106425317 missense probably damaging 0.99
R7040:Zfp90 UTSW 8 106425009 nonsense probably null
R7196:Zfp90 UTSW 8 106425148 missense probably damaging 0.99
R7523:Zfp90 UTSW 8 106423913 missense probably benign 0.07
R7535:Zfp90 UTSW 8 106424268 missense possibly damaging 0.94
R7546:Zfp90 UTSW 8 106424691 missense probably benign 0.22
R7719:Zfp90 UTSW 8 106419093 missense probably damaging 1.00
R8036:Zfp90 UTSW 8 106419128 missense probably benign 0.21
R8056:Zfp90 UTSW 8 106424480 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- ggtcgtgcaaattggtcttc -3'
Posted On2013-05-23