Incidental Mutation 'R0462:Cdh3'
ID41387
Institutional Source Beutler Lab
Gene Symbol Cdh3
Ensembl Gene ENSMUSG00000061048
Gene Namecadherin 3
SynonymsPcad, P-cadherin, Cadp
MMRRC Submission 038662-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.108) question?
Stock #R0462 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location106510891-106557297 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 106555380 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 800 (N800S)
Ref Sequence ENSEMBL: ENSMUSP00000079613 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080797]
PDB Structure
Crystal structure of mouse P-cadherin extracellular domains EC1-EC2 [X-RAY DIFFRACTION]
Predicted Effect possibly damaging
Transcript: ENSMUST00000080797
AA Change: N800S

PolyPhen 2 Score 0.649 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000079613
Gene: ENSMUSG00000061048
AA Change: N800S

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
CA 122 205 7.57e-11 SMART
CA 229 318 1.68e-26 SMART
CA 341 431 4.21e-18 SMART
CA 454 538 1.28e-22 SMART
Pfam:Cadherin_C 673 818 3.9e-46 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.2%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a calcium-dependent cell-cell adhesion protein containing five cadherin domains. The encoded protein plays a role in epithelial outgrowth, such as that which occurs during the development of hair follicles and limb buds. Loss of function of the related gene in humans results in ectodermal dysplasia, ectrodactyly, and macular dystrophy and congential hypotrichosis with juvenile macular dystrophy. This gene is located in the vicinity of similar cadherin genes on chromosome 8. The proprotein is further cleaved into a functional chain. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2013]
PHENOTYPE: Homozygous mutation of this gene results in precocious development of mammary glands in virgin 10-week old females. Aged virgin females (24 weeks) exhibit alveolar hyperplasia, ductal dysplasia, and extensive lymphocyte infiltration of the mammary glands. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700016D06Rik T A 8: 11,661,749 probably benign Het
1700022I11Rik T A 4: 42,973,429 F921I probably benign Het
9530053A07Rik A T 7: 28,137,340 D228V probably damaging Het
Aarsd1 A T 11: 101,414,091 D190E probably damaging Het
Acnat2 A G 4: 49,383,084 probably null Het
Acot10 T G 15: 20,666,626 T10P possibly damaging Het
Aldh7a1 T C 18: 56,534,214 probably null Het
Alkbh7 G A 17: 56,998,443 V87I probably benign Het
Ano2 A T 6: 125,712,275 H121L probably benign Het
Apob A T 12: 8,000,896 Y1040F probably damaging Het
Arhgap25 A T 6: 87,459,960 V636E possibly damaging Het
Atad2b A T 12: 4,941,973 T191S possibly damaging Het
Btbd9 A T 17: 30,530,217 V41D possibly damaging Het
Bzw2 G A 12: 36,124,024 R25C probably damaging Het
Carmil1 T C 13: 24,022,511 S1326G probably benign Het
Cdh18 A G 15: 23,366,885 R226G probably damaging Het
Cep152 A T 2: 125,583,934 V837E possibly damaging Het
Cep85 G A 4: 134,131,421 T713M possibly damaging Het
Chd7 T C 4: 8,850,821 Y1736H probably damaging Het
Chst3 T C 10: 60,186,713 E104G probably benign Het
Cic T A 7: 25,287,140 S1299T probably damaging Het
Cic C A 7: 25,287,141 S1299Y probably damaging Het
Cmah T A 13: 24,436,741 S319R possibly damaging Het
Cnbd1 A G 4: 18,895,044 F233L probably benign Het
Cpne5 T C 17: 29,176,189 E251G probably benign Het
Csf2rb2 G A 15: 78,285,173 P485L probably damaging Het
Dimt1 T C 13: 106,948,756 M70T possibly damaging Het
Dlk2 A G 17: 46,303,098 *383W probably null Het
Dnah2 G A 11: 69,459,201 R2369C probably damaging Het
Dock2 A G 11: 34,268,052 F1173L possibly damaging Het
Dok7 A G 5: 35,066,462 H115R possibly damaging Het
Dpy19l1 A G 9: 24,414,349 I720T probably benign Het
Eps8 A T 6: 137,514,311 D356E probably benign Het
Exoc1 A G 5: 76,543,617 N263D probably benign Het
Fam173b T C 15: 31,616,872 M161T probably damaging Het
Fbxl3 T C 14: 103,082,886 D375G probably damaging Het
Flg2 A T 3: 93,201,437 E257D probably benign Het
Fstl4 A G 11: 53,186,402 D662G probably benign Het
Gbp10 G T 5: 105,218,524 Q505K possibly damaging Het
Gemin2 C T 12: 59,013,519 P15S probably damaging Het
Gm14124 A G 2: 150,269,202 E604G possibly damaging Het
Grhl2 A G 15: 37,344,675 M514V probably benign Het
Hgs A G 11: 120,479,144 N413D possibly damaging Het
Il12rb2 T C 6: 67,303,610 S538G possibly damaging Het
Kdm5a A G 6: 120,402,600 D623G probably damaging Het
Kif1bp A T 10: 62,559,456 I469N probably damaging Het
Matk G T 10: 81,259,693 V116F probably damaging Het
Mcm3 T C 1: 20,805,332 T694A probably benign Het
Mctp1 C A 13: 76,801,401 H260Q probably damaging Het
Mios T A 6: 8,215,743 I313K probably benign Het
Muc4 T A 16: 32,762,536 Y2562N possibly damaging Het
Naip5 T A 13: 100,221,732 I999F probably damaging Het
Olfr128 A T 17: 37,923,776 D70V probably damaging Het
Olfr1375 A G 11: 51,048,509 Y134C probably damaging Het
Olfr68 A T 7: 103,777,563 S261T probably benign Het
Olfr749 T A 14: 50,737,097 I22L probably benign Het
Olfr834 A T 9: 18,988,902 I305F probably benign Het
Olfr965 T A 9: 39,719,410 F61Y probably benign Het
Pafah1b1 A G 11: 74,677,715 V396A probably benign Het
Pard6b T A 2: 168,087,547 I91N possibly damaging Het
Pdzd2 T C 15: 12,592,160 S133G probably damaging Het
Plcg2 T G 8: 117,585,305 S445R probably benign Het
Plekhd1 G T 12: 80,721,578 V396L probably damaging Het
Ppp4r2 A G 6: 100,866,557 D294G possibly damaging Het
Ppwd1 T C 13: 104,222,960 probably null Het
Prr22 A G 17: 56,770,551 probably benign Het
Psme4 A G 11: 30,848,117 D1370G probably damaging Het
Rac3 T A 11: 120,722,858 V86D probably damaging Het
Rnf207 T C 4: 152,313,372 S335G possibly damaging Het
Rxfp3 A G 15: 11,036,977 L103P probably damaging Het
Slc17a3 C T 13: 23,855,858 S293F probably damaging Het
Smpdl3a G T 10: 57,794,731 C17F probably benign Het
Spen A T 4: 141,473,651 I2555N probably damaging Het
Srpk2 G T 5: 23,518,426 T564K probably damaging Het
Stard4 C T 18: 33,205,149 R116H probably damaging Het
Supt7l A T 5: 31,520,296 S175R probably damaging Het
Sycp1 A T 3: 102,819,106 Y932N possibly damaging Het
Tas2r122 T C 6: 132,711,178 M251V probably benign Het
Tbx15 A T 3: 99,316,318 E274V probably damaging Het
Tex52 A G 6: 128,384,954 E298G probably benign Het
Tmem101 T C 11: 102,155,867 M59V probably benign Het
Tmem132b T C 5: 125,785,926 V665A probably damaging Het
Trim23 T C 13: 104,198,033 V347A probably damaging Het
Ush2a A G 1: 188,910,939 H4166R probably benign Het
Vmn2r101 G T 17: 19,590,169 V406L probably benign Het
Vrk3 A G 7: 44,764,200 D166G possibly damaging Het
Washc4 T A 10: 83,556,913 M259K probably benign Het
Wdr70 T C 15: 8,079,161 D167G probably benign Het
Zfp28 A T 7: 6,392,240 Q248L possibly damaging Het
Zfp39 A G 11: 58,890,406 I510T probably benign Het
Zfp710 T A 7: 80,090,341 *646R probably null Het
Zfp90 C T 8: 106,425,260 S535L possibly damaging Het
Zfp949 C T 9: 88,568,734 T119I possibly damaging Het
Other mutations in Cdh3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01103:Cdh3 APN 8 106555305 missense probably damaging 1.00
IGL01431:Cdh3 APN 8 106547669 missense probably damaging 1.00
IGL01466:Cdh3 APN 8 106536595 missense possibly damaging 0.62
IGL01794:Cdh3 APN 8 106537126 missense possibly damaging 0.78
IGL02100:Cdh3 APN 8 106543690 missense probably benign
IGL02272:Cdh3 APN 8 106547836 splice site probably null
IGL02292:Cdh3 APN 8 106545201 missense probably damaging 0.99
IGL02553:Cdh3 APN 8 106544248 nonsense probably null
IGL03245:Cdh3 APN 8 106552999 missense probably damaging 1.00
IGL03376:Cdh3 APN 8 106541404 missense probably benign 0.01
PIT4486001:Cdh3 UTSW 8 106541490 missense possibly damaging 0.89
R0143:Cdh3 UTSW 8 106511225 missense probably benign 0.35
R0388:Cdh3 UTSW 8 106539129 missense probably damaging 1.00
R0526:Cdh3 UTSW 8 106555446 missense possibly damaging 0.69
R0788:Cdh3 UTSW 8 106541415 missense probably benign 0.05
R1495:Cdh3 UTSW 8 106538997 missense probably damaging 1.00
R1653:Cdh3 UTSW 8 106539068 missense probably damaging 1.00
R1806:Cdh3 UTSW 8 106536915 missense probably benign 0.02
R2124:Cdh3 UTSW 8 106552888 missense probably damaging 1.00
R2302:Cdh3 UTSW 8 106545069 missense probably damaging 1.00
R2326:Cdh3 UTSW 8 106511308 missense probably benign
R2508:Cdh3 UTSW 8 106552407 missense probably damaging 1.00
R3625:Cdh3 UTSW 8 106543678 missense probably damaging 0.98
R3767:Cdh3 UTSW 8 106536974 splice site probably null
R4679:Cdh3 UTSW 8 106539856 missense probably damaging 1.00
R4716:Cdh3 UTSW 8 106543888 missense probably benign
R4778:Cdh3 UTSW 8 106543826 missense probably damaging 0.98
R4928:Cdh3 UTSW 8 106536610 missense probably benign 0.15
R5069:Cdh3 UTSW 8 106536826 missense probably benign 0.19
R5101:Cdh3 UTSW 8 106541392 missense possibly damaging 0.60
R5204:Cdh3 UTSW 8 106544239 missense probably benign 0.29
R5309:Cdh3 UTSW 8 106539020 missense probably damaging 0.98
R5343:Cdh3 UTSW 8 106552936 missense probably benign
R5408:Cdh3 UTSW 8 106536637 missense probably damaging 0.98
R6253:Cdh3 UTSW 8 106537063 splice site probably null
R6637:Cdh3 UTSW 8 106511341 missense probably benign
R6639:Cdh3 UTSW 8 106511341 missense probably benign
R7142:Cdh3 UTSW 8 106545228 critical splice donor site probably null
R7371:Cdh3 UTSW 8 106552477 missense probably damaging 1.00
R7397:Cdh3 UTSW 8 106536609 nonsense probably null
R7458:Cdh3 UTSW 8 106537147 missense probably damaging 1.00
R7512:Cdh3 UTSW 8 106539008 nonsense probably null
R7522:Cdh3 UTSW 8 106541373 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCAATGCTGACCGCTGCTCTC -3'
(R):5'- CATCCTTCCATCGGAAAGGCTCAC -3'

Sequencing Primer
(F):5'- CTGCTTCCCTAGAACCTGAAGG -3'
(R):5'- AGGCCACTTCTGGGCAAAC -3'
Posted On2013-05-23