Mutagenetix > Incidental Mutation

Incidental Mutation 'R0462:Psme4'

41399

Institutional Source

Beutler Lab

Gene Symbol

Psme4

Ensembl Gene

ENSMUSG00000040850

Gene Name

proteasome (prosome, macropain) activator subunit 4

Synonyms

MMRRC Submission

038662-MU

Accession Numbers

Genbank: NM_134013

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0462 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

30771726-30880361 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 30848117 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 1370 (D1370G)

Ref Sequence

ENSEMBL: ENSMUSP00000045460 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041231] [ENSMUST00000129824]

AlphaFold

Q5SSW2

Predicted Effect

probably damaging
Transcript: ENSMUST00000041231
AA Change: D1370G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000045460
Gene: ENSMUSG00000040850
AA Change: D1370G

Domain	Start	End	E-Value	Type
low complexity region	2	19	N/A	INTRINSIC
low complexity region	122	133	N/A	INTRINSIC
Pfam:BLM10_mid	330	828	8.8e-119	PFAM
SCOP:d1b3ua_	1183	1716	3e-14	SMART
Pfam:DUF3437	1756	1843	5.3e-39	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000129824

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.5%
20x: 93.2%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a knock-out allele show normal repair of DNA double-strand breaks but exhibit significantly reduced male fertility due to defects in spermatogenesis observed in both meiotic spermatocytes and postmeiotic haploid spermatids. [provided by MGI curators]

Allele List at MGI

All alleles(25) : Targeted, knock-out(1) Gene trapped(24)

Other mutations in this stock

Total: 93 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700016D06Rik	T	A	8: 11,661,749		probably benign	Het
1700022I11Rik	T	A	4: 42,973,429	F921I	probably benign	Het
9530053A07Rik	A	T	7: 28,137,340	D228V	probably damaging	Het
Aarsd1	A	T	11: 101,414,091	D190E	probably damaging	Het
Acnat2	A	G	4: 49,383,084		probably null	Het
Acot10	T	G	15: 20,666,626	T10P	possibly damaging	Het
Aldh7a1	T	C	18: 56,534,214		probably null	Het
Alkbh7	G	A	17: 56,998,443	V87I	probably benign	Het
Ano2	A	T	6: 125,712,275	H121L	probably benign	Het
Apob	A	T	12: 8,000,896	Y1040F	probably damaging	Het
Arhgap25	A	T	6: 87,459,960	V636E	possibly damaging	Het
Atad2b	A	T	12: 4,941,973	T191S	possibly damaging	Het
Btbd9	A	T	17: 30,530,217	V41D	possibly damaging	Het
Bzw2	G	A	12: 36,124,024	R25C	probably damaging	Het
Carmil1	T	C	13: 24,022,511	S1326G	probably benign	Het
Cdh18	A	G	15: 23,366,885	R226G	probably damaging	Het
Cdh3	A	G	8: 106,555,380	N800S	possibly damaging	Het
Cep152	A	T	2: 125,583,934	V837E	possibly damaging	Het
Cep85	G	A	4: 134,131,421	T713M	possibly damaging	Het
Chd7	T	C	4: 8,850,821	Y1736H	probably damaging	Het
Chst3	T	C	10: 60,186,713	E104G	probably benign	Het
Cic	C	A	7: 25,287,141	S1299Y	probably damaging	Het
Cic	T	A	7: 25,287,140	S1299T	probably damaging	Het
Cmah	T	A	13: 24,436,741	S319R	possibly damaging	Het
Cnbd1	A	G	4: 18,895,044	F233L	probably benign	Het
Cpne5	T	C	17: 29,176,189	E251G	probably benign	Het
Csf2rb2	G	A	15: 78,285,173	P485L	probably damaging	Het
Dimt1	T	C	13: 106,948,756	M70T	possibly damaging	Het
Dlk2	A	G	17: 46,303,098	*383W	probably null	Het
Dnah2	G	A	11: 69,459,201	R2369C	probably damaging	Het
Dock2	A	G	11: 34,268,052	F1173L	possibly damaging	Het
Dok7	A	G	5: 35,066,462	H115R	possibly damaging	Het
Dpy19l1	A	G	9: 24,414,349	I720T	probably benign	Het
Eps8	A	T	6: 137,514,311	D356E	probably benign	Het
Exoc1	A	G	5: 76,543,617	N263D	probably benign	Het
Fam173b	T	C	15: 31,616,872	M161T	probably damaging	Het
Fbxl3	T	C	14: 103,082,886	D375G	probably damaging	Het
Flg2	A	T	3: 93,201,437	E257D	probably benign	Het
Fstl4	A	G	11: 53,186,402	D662G	probably benign	Het
Gbp10	G	T	5: 105,218,524	Q505K	possibly damaging	Het
Gemin2	C	T	12: 59,013,519	P15S	probably damaging	Het
Gm14124	A	G	2: 150,269,202	E604G	possibly damaging	Het
Grhl2	A	G	15: 37,344,675	M514V	probably benign	Het
Hgs	A	G	11: 120,479,144	N413D	possibly damaging	Het
Il12rb2	T	C	6: 67,303,610	S538G	possibly damaging	Het
Kdm5a	A	G	6: 120,402,600	D623G	probably damaging	Het
Kif1bp	A	T	10: 62,559,456	I469N	probably damaging	Het
Matk	G	T	10: 81,259,693	V116F	probably damaging	Het
Mcm3	T	C	1: 20,805,332	T694A	probably benign	Het
Mctp1	C	A	13: 76,801,401	H260Q	probably damaging	Het
Mios	T	A	6: 8,215,743	I313K	probably benign	Het
Muc4	T	A	16: 32,762,536	Y2562N	possibly damaging	Het
Naip5	T	A	13: 100,221,732	I999F	probably damaging	Het
Olfr128	A	T	17: 37,923,776	D70V	probably damaging	Het
Olfr1375	A	G	11: 51,048,509	Y134C	probably damaging	Het
Olfr68	A	T	7: 103,777,563	S261T	probably benign	Het
Olfr749	T	A	14: 50,737,097	I22L	probably benign	Het
Olfr834	A	T	9: 18,988,902	I305F	probably benign	Het
Olfr965	T	A	9: 39,719,410	F61Y	probably benign	Het
Pafah1b1	A	G	11: 74,677,715	V396A	probably benign	Het
Pard6b	T	A	2: 168,087,547	I91N	possibly damaging	Het
Pdzd2	T	C	15: 12,592,160	S133G	probably damaging	Het
Plcg2	T	G	8: 117,585,305	S445R	probably benign	Het
Plekhd1	G	T	12: 80,721,578	V396L	probably damaging	Het
Ppp4r2	A	G	6: 100,866,557	D294G	possibly damaging	Het
Ppwd1	T	C	13: 104,222,960		probably null	Het
Prr22	A	G	17: 56,770,551		probably benign	Het
Rac3	T	A	11: 120,722,858	V86D	probably damaging	Het
Rnf207	T	C	4: 152,313,372	S335G	possibly damaging	Het
Rxfp3	A	G	15: 11,036,977	L103P	probably damaging	Het
Slc17a3	C	T	13: 23,855,858	S293F	probably damaging	Het
Smpdl3a	G	T	10: 57,794,731	C17F	probably benign	Het
Spen	A	T	4: 141,473,651	I2555N	probably damaging	Het
Srpk2	G	T	5: 23,518,426	T564K	probably damaging	Het
Stard4	C	T	18: 33,205,149	R116H	probably damaging	Het
Supt7l	A	T	5: 31,520,296	S175R	probably damaging	Het
Sycp1	A	T	3: 102,819,106	Y932N	possibly damaging	Het
Tas2r122	T	C	6: 132,711,178	M251V	probably benign	Het
Tbx15	A	T	3: 99,316,318	E274V	probably damaging	Het
Tex52	A	G	6: 128,384,954	E298G	probably benign	Het
Tmem101	T	C	11: 102,155,867	M59V	probably benign	Het
Tmem132b	T	C	5: 125,785,926	V665A	probably damaging	Het
Trim23	T	C	13: 104,198,033	V347A	probably damaging	Het
Ush2a	A	G	1: 188,910,939	H4166R	probably benign	Het
Vmn2r101	G	T	17: 19,590,169	V406L	probably benign	Het
Vrk3	A	G	7: 44,764,200	D166G	possibly damaging	Het
Washc4	T	A	10: 83,556,913	M259K	probably benign	Het
Wdr70	T	C	15: 8,079,161	D167G	probably benign	Het
Zfp28	A	T	7: 6,392,240	Q248L	possibly damaging	Het
Zfp39	A	G	11: 58,890,406	I510T	probably benign	Het
Zfp710	T	A	7: 80,090,341	*646R	probably null	Het
Zfp90	C	T	8: 106,425,260	S535L	possibly damaging	Het
Zfp949	C	T	9: 88,568,734	T119I	possibly damaging	Het

Other mutations in Psme4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00228:Psme4	APN	11	30815710	critical splice donor site	probably null
IGL00401:Psme4	APN	11	30821079	splice site	probably benign
IGL00475:Psme4	APN	11	30845252	missense	probably benign	0.14
IGL00576:Psme4	APN	11	30823145	missense	possibly damaging	0.50
IGL00817:Psme4	APN	11	30820129	missense	probably benign	0.01
IGL01525:Psme4	APN	11	30809936	splice site	probably benign
IGL01862:Psme4	APN	11	30812038	nonsense	probably null
IGL02310:Psme4	APN	11	30837484	missense	probably benign	0.06
IGL02477:Psme4	APN	11	30842083	missense	probably damaging	0.99
IGL02545:Psme4	APN	11	30841586	missense	possibly damaging	0.81
IGL02608:Psme4	APN	11	30820944	missense	probably benign	0.34
IGL02621:Psme4	APN	11	30848131	missense	probably benign
IGL02822:Psme4	APN	11	30848204	unclassified	probably benign
IGL02833:Psme4	APN	11	30850715	unclassified	probably benign
IGL02964:Psme4	APN	11	30791095	nonsense	probably null
IGL03273:Psme4	APN	11	30848130	missense	probably damaging	1.00
IGL03348:Psme4	APN	11	30876796	missense	probably damaging	1.00
IGL03382:Psme4	APN	11	30807788	missense	possibly damaging	0.94
H2330:Psme4	UTSW	11	30851210	missense	probably benign	0.17
PIT4378001:Psme4	UTSW	11	30821079	splice site	probably benign
R0276:Psme4	UTSW	11	30811980	missense	probably damaging	1.00
R0685:Psme4	UTSW	11	30878415	missense	probably damaging	1.00
R0766:Psme4	UTSW	11	30807687	splice site	probably null
R0830:Psme4	UTSW	11	30807797	missense	possibly damaging	0.53
R0940:Psme4	UTSW	11	30815264	missense	possibly damaging	0.53
R1018:Psme4	UTSW	11	30804310	missense	probably damaging	1.00
R1312:Psme4	UTSW	11	30807687	splice site	probably null
R1448:Psme4	UTSW	11	30852744	missense	probably damaging	1.00
R1713:Psme4	UTSW	11	30806310	missense	probably damaging	1.00
R1732:Psme4	UTSW	11	30848105	missense	probably benign	0.03
R1813:Psme4	UTSW	11	30804353	missense	probably benign	0.14
R1905:Psme4	UTSW	11	30810922	missense	probably damaging	1.00
R1907:Psme4	UTSW	11	30810922	missense	probably damaging	1.00
R1911:Psme4	UTSW	11	30815658	missense	probably benign	0.02
R1956:Psme4	UTSW	11	30832424	missense	probably damaging	0.99
R1974:Psme4	UTSW	11	30819011	missense	probably benign	0.00
R1980:Psme4	UTSW	11	30832615	missense	possibly damaging	0.84
R1986:Psme4	UTSW	11	30830352	missense	probably benign	0.01
R2046:Psme4	UTSW	11	30817723	splice site	probably benign
R2142:Psme4	UTSW	11	30820998	missense	possibly damaging	0.89
R2698:Psme4	UTSW	11	30874282	critical splice donor site	probably null
R2844:Psme4	UTSW	11	30845173	splice site	probably benign
R3807:Psme4	UTSW	11	30856027	splice site	probably null
R3876:Psme4	UTSW	11	30856068	missense	probably damaging	0.99
R4420:Psme4	UTSW	11	30812028	missense	possibly damaging	0.67
R4584:Psme4	UTSW	11	30834318	missense	probably damaging	1.00
R4615:Psme4	UTSW	11	30834287	missense	probably benign	0.02
R4714:Psme4	UTSW	11	30832573	missense	probably benign	0.02
R5008:Psme4	UTSW	11	30856896	intron	probably benign
R5109:Psme4	UTSW	11	30791095	nonsense	probably null
R5155:Psme4	UTSW	11	30876806	missense	probably damaging	1.00
R5199:Psme4	UTSW	11	30853272	missense	probably benign	0.00
R5205:Psme4	UTSW	11	30832666	intron	probably benign
R5452:Psme4	UTSW	11	30791168	missense	probably benign
R5491:Psme4	UTSW	11	30815246	missense	possibly damaging	0.63
R5685:Psme4	UTSW	11	30809837	missense	probably damaging	0.99
R5764:Psme4	UTSW	11	30772364	intron	probably benign
R5853:Psme4	UTSW	11	30791234	critical splice donor site	probably null
R5865:Psme4	UTSW	11	30791993	missense	possibly damaging	0.95
R5903:Psme4	UTSW	11	30841589	missense	probably benign	0.28
R5927:Psme4	UTSW	11	30804294	missense	possibly damaging	0.82
R6004:Psme4	UTSW	11	30856896	intron	probably benign
R6102:Psme4	UTSW	11	30865567	missense	probably damaging	1.00
R6247:Psme4	UTSW	11	30853245	missense	possibly damaging	0.60
R6527:Psme4	UTSW	11	30832175	missense	probably benign
R6750:Psme4	UTSW	11	30853203	missense	probably damaging	1.00
R6885:Psme4	UTSW	11	30834307	nonsense	probably null
R6939:Psme4	UTSW	11	30837291	missense	probably damaging	0.99
R6945:Psme4	UTSW	11	30837437	missense	probably benign	0.06
R7029:Psme4	UTSW	11	30772474	intron	probably benign
R7049:Psme4	UTSW	11	30813904	splice site	probably null
R7098:Psme4	UTSW	11	30850661	missense	probably damaging	0.99
R7107:Psme4	UTSW	11	30848105	missense	probably benign	0.03
R7223:Psme4	UTSW	11	30874226	missense	probably benign	0.33
R7319:Psme4	UTSW	11	30807790	missense	probably benign	0.00
R7375:Psme4	UTSW	11	30772700	splice site	probably null
R7410:Psme4	UTSW	11	30815279	nonsense	probably null
R7469:Psme4	UTSW	11	30802837	missense	probably benign	0.20
R7651:Psme4	UTSW	11	30837334	missense	probably damaging	0.98
R7679:Psme4	UTSW	11	30878425	missense	probably damaging	0.99
R7681:Psme4	UTSW	11	30791975	missense	possibly damaging	0.63
R7822:Psme4	UTSW	11	30874245	missense	probably benign
R8013:Psme4	UTSW	11	30804320	missense	probably benign	0.06
R8130:Psme4	UTSW	11	30842026	missense	probably damaging	1.00
R8323:Psme4	UTSW	11	30843532	missense	probably damaging	0.99
R8330:Psme4	UTSW	11	30843583	missense	probably benign	0.00
R8363:Psme4	UTSW	11	30812139	missense	probably damaging	1.00
R8491:Psme4	UTSW	11	30772161	missense	possibly damaging	0.90
R8690:Psme4	UTSW	11	30837319	missense	probably benign	0.00
R8696:Psme4	UTSW	11	30809896	missense	probably damaging	0.99
R8743:Psme4	UTSW	11	30878467	missense	probably damaging	1.00
R8998:Psme4	UTSW	11	30838957	missense	possibly damaging	0.78
R9241:Psme4	UTSW	11	30865576	missense	probably damaging	1.00
R9657:Psme4	UTSW	11	30838980	missense	probably benign	0.00
R9736:Psme4	UTSW	11	30847411	missense	probably damaging	0.99
R9744:Psme4	UTSW	11	30815294	critical splice donor site	probably null
R9746:Psme4	UTSW	11	30876868	nonsense	probably null
V5088:Psme4	UTSW	11	30851210	missense	probably benign	0.17
X0063:Psme4	UTSW	11	30832600	missense	possibly damaging	0.66
Z1176:Psme4	UTSW	11	30843522	missense	possibly damaging	0.87
Z1177:Psme4	UTSW	11	30806311	missense	probably damaging	1.00
Z1177:Psme4	UTSW	11	30812138	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AAGTTTAGTCCCCGGCGTTTCTG -3'
(R):5'- CGAGTCTTGGTATGACTTATGTGACCTG -3'

Sequencing Primer
(F):5'- gttcagttcccagcgacc -3'
(R):5'- CCTGGATAAATGATTAACAAAAACCC -3'

Posted On

2013-05-23