Incidental Mutation 'R0462:Dnah2'
ID41404
Institutional Source Beutler Lab
Gene Symbol Dnah2
Ensembl Gene ENSMUSG00000005237
Gene Namedynein, axonemal, heavy chain 2
SynonymsDnahc2, Dnhd3, D330014H01Rik, 2900022L05Rik
MMRRC Submission 038662-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0462 (G1)
Quality Score206
Status Not validated
Chromosome11
Chromosomal Location69420809-69549110 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 69459201 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 2369 (R2369C)
Ref Sequence ENSEMBL: ENSMUSP00000104299 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035539] [ENSMUST00000108659]
Predicted Effect probably damaging
Transcript: ENSMUST00000035539
AA Change: R2363C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000047329
Gene: ENSMUSG00000005237
AA Change: R2363C

DomainStartEndE-ValueType
low complexity region 4 25 N/A INTRINSIC
Pfam:DHC_N1 273 429 6.6e-37 PFAM
Pfam:DHC_N1 432 761 1.3e-54 PFAM
Pfam:DHC_N2 1253 1668 3.4e-144 PFAM
AAA 1826 1962 2.95e-1 SMART
Pfam:AAA_5 2108 2251 1.3e-5 PFAM
AAA 2437 2584 3.63e-5 SMART
Pfam:AAA_8 2752 3022 1.1e-75 PFAM
Pfam:MT 3034 3370 8.7e-55 PFAM
Pfam:AAA_9 3386 3616 7.4e-68 PFAM
Pfam:Dynein_heavy 3748 4453 1.2e-220 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108659
AA Change: R2369C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104299
Gene: ENSMUSG00000005237
AA Change: R2369C

DomainStartEndE-ValueType
low complexity region 4 25 N/A INTRINSIC
Pfam:DHC_N1 274 429 1.1e-47 PFAM
Pfam:DHC_N1 438 760 1.5e-75 PFAM
Pfam:DHC_N2 1255 1666 4.4e-144 PFAM
low complexity region 1711 1720 N/A INTRINSIC
AAA 1832 1968 2.95e-1 SMART
Blast:AAA 2111 2251 2e-86 BLAST
AAA 2443 2590 3.63e-5 SMART
Pfam:AAA_8 2758 3028 5.5e-77 PFAM
Pfam:MT 3040 3376 7.6e-55 PFAM
Pfam:AAA_9 3396 3621 7.5e-94 PFAM
Pfam:Dynein_heavy 3759 4458 4.9e-264 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Dyneins are microtubule-associated motor protein complexes composed of several heavy, light, and intermediate chains. The axonemal dyneins, found in cilia and flagella, are components of the outer and inner dynein arms attached to the peripheral microtubule doublets. DNAH2 is an axonemal inner arm dynein heavy chain (Chapelin et al., 1997 [PubMed 9256245]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700016D06Rik T A 8: 11,661,749 probably benign Het
1700022I11Rik T A 4: 42,973,429 F921I probably benign Het
9530053A07Rik A T 7: 28,137,340 D228V probably damaging Het
Aarsd1 A T 11: 101,414,091 D190E probably damaging Het
Acnat2 A G 4: 49,383,084 probably null Het
Acot10 T G 15: 20,666,626 T10P possibly damaging Het
Aldh7a1 T C 18: 56,534,214 probably null Het
Alkbh7 G A 17: 56,998,443 V87I probably benign Het
Ano2 A T 6: 125,712,275 H121L probably benign Het
Apob A T 12: 8,000,896 Y1040F probably damaging Het
Arhgap25 A T 6: 87,459,960 V636E possibly damaging Het
Atad2b A T 12: 4,941,973 T191S possibly damaging Het
Btbd9 A T 17: 30,530,217 V41D possibly damaging Het
Bzw2 G A 12: 36,124,024 R25C probably damaging Het
Carmil1 T C 13: 24,022,511 S1326G probably benign Het
Cdh18 A G 15: 23,366,885 R226G probably damaging Het
Cdh3 A G 8: 106,555,380 N800S possibly damaging Het
Cep152 A T 2: 125,583,934 V837E possibly damaging Het
Cep85 G A 4: 134,131,421 T713M possibly damaging Het
Chd7 T C 4: 8,850,821 Y1736H probably damaging Het
Chst3 T C 10: 60,186,713 E104G probably benign Het
Cic T A 7: 25,287,140 S1299T probably damaging Het
Cic C A 7: 25,287,141 S1299Y probably damaging Het
Cmah T A 13: 24,436,741 S319R possibly damaging Het
Cnbd1 A G 4: 18,895,044 F233L probably benign Het
Cpne5 T C 17: 29,176,189 E251G probably benign Het
Csf2rb2 G A 15: 78,285,173 P485L probably damaging Het
Dimt1 T C 13: 106,948,756 M70T possibly damaging Het
Dlk2 A G 17: 46,303,098 *383W probably null Het
Dock2 A G 11: 34,268,052 F1173L possibly damaging Het
Dok7 A G 5: 35,066,462 H115R possibly damaging Het
Dpy19l1 A G 9: 24,414,349 I720T probably benign Het
Eps8 A T 6: 137,514,311 D356E probably benign Het
Exoc1 A G 5: 76,543,617 N263D probably benign Het
Fam173b T C 15: 31,616,872 M161T probably damaging Het
Fbxl3 T C 14: 103,082,886 D375G probably damaging Het
Flg2 A T 3: 93,201,437 E257D probably benign Het
Fstl4 A G 11: 53,186,402 D662G probably benign Het
Gbp10 G T 5: 105,218,524 Q505K possibly damaging Het
Gemin2 C T 12: 59,013,519 P15S probably damaging Het
Gm14124 A G 2: 150,269,202 E604G possibly damaging Het
Grhl2 A G 15: 37,344,675 M514V probably benign Het
Hgs A G 11: 120,479,144 N413D possibly damaging Het
Il12rb2 T C 6: 67,303,610 S538G possibly damaging Het
Kdm5a A G 6: 120,402,600 D623G probably damaging Het
Kif1bp A T 10: 62,559,456 I469N probably damaging Het
Matk G T 10: 81,259,693 V116F probably damaging Het
Mcm3 T C 1: 20,805,332 T694A probably benign Het
Mctp1 C A 13: 76,801,401 H260Q probably damaging Het
Mios T A 6: 8,215,743 I313K probably benign Het
Muc4 T A 16: 32,762,536 Y2562N possibly damaging Het
Naip5 T A 13: 100,221,732 I999F probably damaging Het
Olfr128 A T 17: 37,923,776 D70V probably damaging Het
Olfr1375 A G 11: 51,048,509 Y134C probably damaging Het
Olfr68 A T 7: 103,777,563 S261T probably benign Het
Olfr749 T A 14: 50,737,097 I22L probably benign Het
Olfr834 A T 9: 18,988,902 I305F probably benign Het
Olfr965 T A 9: 39,719,410 F61Y probably benign Het
Pafah1b1 A G 11: 74,677,715 V396A probably benign Het
Pard6b T A 2: 168,087,547 I91N possibly damaging Het
Pdzd2 T C 15: 12,592,160 S133G probably damaging Het
Plcg2 T G 8: 117,585,305 S445R probably benign Het
Plekhd1 G T 12: 80,721,578 V396L probably damaging Het
Ppp4r2 A G 6: 100,866,557 D294G possibly damaging Het
Ppwd1 T C 13: 104,222,960 probably null Het
Prr22 A G 17: 56,770,551 probably benign Het
Psme4 A G 11: 30,848,117 D1370G probably damaging Het
Rac3 T A 11: 120,722,858 V86D probably damaging Het
Rnf207 T C 4: 152,313,372 S335G possibly damaging Het
Rxfp3 A G 15: 11,036,977 L103P probably damaging Het
Slc17a3 C T 13: 23,855,858 S293F probably damaging Het
Smpdl3a G T 10: 57,794,731 C17F probably benign Het
Spen A T 4: 141,473,651 I2555N probably damaging Het
Srpk2 G T 5: 23,518,426 T564K probably damaging Het
Stard4 C T 18: 33,205,149 R116H probably damaging Het
Supt7l A T 5: 31,520,296 S175R probably damaging Het
Sycp1 A T 3: 102,819,106 Y932N possibly damaging Het
Tas2r122 T C 6: 132,711,178 M251V probably benign Het
Tbx15 A T 3: 99,316,318 E274V probably damaging Het
Tex52 A G 6: 128,384,954 E298G probably benign Het
Tmem101 T C 11: 102,155,867 M59V probably benign Het
Tmem132b T C 5: 125,785,926 V665A probably damaging Het
Trim23 T C 13: 104,198,033 V347A probably damaging Het
Ush2a A G 1: 188,910,939 H4166R probably benign Het
Vmn2r101 G T 17: 19,590,169 V406L probably benign Het
Vrk3 A G 7: 44,764,200 D166G possibly damaging Het
Washc4 T A 10: 83,556,913 M259K probably benign Het
Wdr70 T C 15: 8,079,161 D167G probably benign Het
Zfp28 A T 7: 6,392,240 Q248L possibly damaging Het
Zfp39 A G 11: 58,890,406 I510T probably benign Het
Zfp710 T A 7: 80,090,341 *646R probably null Het
Zfp90 C T 8: 106,425,260 S535L possibly damaging Het
Zfp949 C T 9: 88,568,734 T119I possibly damaging Het
Other mutations in Dnah2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Dnah2 APN 11 69492672 missense possibly damaging 0.93
IGL00418:Dnah2 APN 11 69495066 splice site probably benign
IGL00772:Dnah2 APN 11 69451257 missense probably damaging 0.97
IGL00819:Dnah2 APN 11 69473350 critical splice donor site probably null
IGL00827:Dnah2 APN 11 69448457 missense probably damaging 1.00
IGL01060:Dnah2 APN 11 69478092 missense possibly damaging 0.86
IGL01340:Dnah2 APN 11 69493184 missense probably damaging 0.99
IGL01349:Dnah2 APN 11 69475606 missense probably damaging 0.99
IGL01413:Dnah2 APN 11 69432964 missense probably damaging 0.99
IGL01451:Dnah2 APN 11 69474191 splice site probably benign
IGL01480:Dnah2 APN 11 69458371 missense possibly damaging 0.91
IGL01537:Dnah2 APN 11 69516080 missense probably benign 0.17
IGL01592:Dnah2 APN 11 69431087 missense probably benign 0.14
IGL01612:Dnah2 APN 11 69465063 splice site probably benign
IGL01667:Dnah2 APN 11 69544395 missense probably benign
IGL01667:Dnah2 APN 11 69520941 missense probably damaging 0.98
IGL01691:Dnah2 APN 11 69539443 missense probably benign
IGL02019:Dnah2 APN 11 69474285 missense probably damaging 1.00
IGL02039:Dnah2 APN 11 69499212 missense probably damaging 1.00
IGL02076:Dnah2 APN 11 69422559 missense probably damaging 0.99
IGL02085:Dnah2 APN 11 69458185 missense probably benign 0.07
IGL02158:Dnah2 APN 11 69458123 missense probably benign
IGL02381:Dnah2 APN 11 69446292 missense probably benign 0.25
IGL02681:Dnah2 APN 11 69452933 missense probably benign 0.40
IGL02957:Dnah2 APN 11 69448507 missense possibly damaging 0.96
IGL02961:Dnah2 APN 11 69518414 missense probably damaging 1.00
IGL02969:Dnah2 APN 11 69521187 missense possibly damaging 0.80
IGL03117:Dnah2 APN 11 69436291 splice site probably benign
IGL03120:Dnah2 APN 11 69421848 missense probably damaging 1.00
IGL03183:Dnah2 APN 11 69458488 missense possibly damaging 0.94
IGL03197:Dnah2 APN 11 69459263 missense probably damaging 1.00
IGL03263:Dnah2 APN 11 69529381 critical splice donor site probably null
IGL03333:Dnah2 APN 11 69495123 missense probably damaging 1.00
IGL03338:Dnah2 APN 11 69496577 missense probably benign 0.13
argyrios UTSW 11 69516590 missense possibly damaging 0.47
Aureus UTSW 11 69429348 missense probably damaging 1.00
platinum UTSW 11 69458042 missense probably damaging 0.96
E0370:Dnah2 UTSW 11 69515615 splice site probably null
P0026:Dnah2 UTSW 11 69464947 missense probably damaging 1.00
R0133:Dnah2 UTSW 11 69421009 missense probably damaging 1.00
R0190:Dnah2 UTSW 11 69435249 missense probably damaging 1.00
R0334:Dnah2 UTSW 11 69436836 missense probably damaging 1.00
R0359:Dnah2 UTSW 11 69529531 missense probably benign 0.00
R0386:Dnah2 UTSW 11 69447861 missense probably damaging 1.00
R0414:Dnah2 UTSW 11 69499238 missense probably benign 0.26
R0427:Dnah2 UTSW 11 69452879 missense probably damaging 0.99
R0433:Dnah2 UTSW 11 69459288 missense probably damaging 1.00
R0442:Dnah2 UTSW 11 69448542 missense probably damaging 1.00
R0463:Dnah2 UTSW 11 69423126 missense probably damaging 1.00
R0611:Dnah2 UTSW 11 69499194 missense probably damaging 1.00
R0626:Dnah2 UTSW 11 69477683 missense probably benign 0.07
R0924:Dnah2 UTSW 11 69421308 missense probably damaging 1.00
R0968:Dnah2 UTSW 11 69448519 missense possibly damaging 0.67
R1066:Dnah2 UTSW 11 69447819 missense probably damaging 1.00
R1183:Dnah2 UTSW 11 69446648 missense possibly damaging 0.95
R1184:Dnah2 UTSW 11 69499190 missense probably damaging 1.00
R1186:Dnah2 UTSW 11 69515700 missense probably damaging 0.99
R1453:Dnah2 UTSW 11 69451050 missense probably damaging 0.99
R1498:Dnah2 UTSW 11 69520667 intron probably null
R1538:Dnah2 UTSW 11 69477202 missense probably benign 0.17
R1574:Dnah2 UTSW 11 69514688 missense probably benign 0.26
R1574:Dnah2 UTSW 11 69514688 missense probably benign 0.26
R1590:Dnah2 UTSW 11 69422754 critical splice donor site probably null
R1590:Dnah2 UTSW 11 69521198 missense probably benign 0.00
R1655:Dnah2 UTSW 11 69473854 missense probably damaging 1.00
R1695:Dnah2 UTSW 11 69514691 missense possibly damaging 0.74
R1726:Dnah2 UTSW 11 69497889 missense probably damaging 1.00
R1764:Dnah2 UTSW 11 69423543 missense probably damaging 1.00
R1815:Dnah2 UTSW 11 69475574 missense probably damaging 1.00
R1822:Dnah2 UTSW 11 69514804 missense probably damaging 1.00
R1859:Dnah2 UTSW 11 69437886 missense probably damaging 0.99
R1911:Dnah2 UTSW 11 69515752 missense possibly damaging 0.64
R1913:Dnah2 UTSW 11 69464930 missense probably damaging 1.00
R1981:Dnah2 UTSW 11 69474325 missense probably damaging 1.00
R2010:Dnah2 UTSW 11 69458358 critical splice donor site probably null
R2016:Dnah2 UTSW 11 69437070 missense probably damaging 0.97
R2017:Dnah2 UTSW 11 69437070 missense probably damaging 0.97
R2044:Dnah2 UTSW 11 69524240 missense probably benign 0.14
R2077:Dnah2 UTSW 11 69496606 missense possibly damaging 0.73
R2096:Dnah2 UTSW 11 69455916 missense probably damaging 0.98
R2099:Dnah2 UTSW 11 69493237 missense probably damaging 1.00
R2127:Dnah2 UTSW 11 69458185 missense probably benign 0.02
R2128:Dnah2 UTSW 11 69458185 missense probably benign 0.02
R2146:Dnah2 UTSW 11 69515761 missense probably benign 0.14
R2147:Dnah2 UTSW 11 69515761 missense probably benign 0.14
R2150:Dnah2 UTSW 11 69515761 missense probably benign 0.14
R2404:Dnah2 UTSW 11 69437221 missense probably damaging 0.99
R2510:Dnah2 UTSW 11 69524206 nonsense probably null
R2517:Dnah2 UTSW 11 69516644 missense probably damaging 1.00
R3014:Dnah2 UTSW 11 69430478 missense probably benign
R3741:Dnah2 UTSW 11 69448469 missense probably damaging 1.00
R3814:Dnah2 UTSW 11 69492650 splice site probably null
R3872:Dnah2 UTSW 11 69429348 missense probably damaging 1.00
R3873:Dnah2 UTSW 11 69429348 missense probably damaging 1.00
R3874:Dnah2 UTSW 11 69429348 missense probably damaging 1.00
R3875:Dnah2 UTSW 11 69429348 missense probably damaging 1.00
R3881:Dnah2 UTSW 11 69451347 missense possibly damaging 0.94
R3953:Dnah2 UTSW 11 69454103 missense probably damaging 1.00
R3956:Dnah2 UTSW 11 69484021 missense probably benign 0.00
R4501:Dnah2 UTSW 11 69477659 missense probably benign
R4515:Dnah2 UTSW 11 69465631 missense possibly damaging 0.61
R4612:Dnah2 UTSW 11 69483367 missense possibly damaging 0.93
R4625:Dnah2 UTSW 11 69463661 missense probably damaging 1.00
R4627:Dnah2 UTSW 11 69465376 missense probably damaging 1.00
R4642:Dnah2 UTSW 11 69496559 missense probably benign 0.00
R4683:Dnah2 UTSW 11 69458942 missense probably damaging 1.00
R4698:Dnah2 UTSW 11 69498532 missense probably damaging 1.00
R4710:Dnah2 UTSW 11 69478077 missense probably damaging 1.00
R4712:Dnah2 UTSW 11 69516590 missense possibly damaging 0.47
R4713:Dnah2 UTSW 11 69476688 missense probably damaging 1.00
R4717:Dnah2 UTSW 11 69429357 missense probably benign 0.00
R4740:Dnah2 UTSW 11 69458042 missense probably damaging 0.96
R4780:Dnah2 UTSW 11 69473871 missense probably damaging 0.97
R4825:Dnah2 UTSW 11 69423205 missense probably damaging 1.00
R4864:Dnah2 UTSW 11 69422590 missense probably damaging 0.98
R4868:Dnah2 UTSW 11 69463648 missense probably damaging 1.00
R4879:Dnah2 UTSW 11 69476691 missense probably damaging 1.00
R4908:Dnah2 UTSW 11 69521147 missense probably benign 0.00
R4911:Dnah2 UTSW 11 69499104 critical splice donor site probably null
R4954:Dnah2 UTSW 11 69539496 missense possibly damaging 0.61
R4962:Dnah2 UTSW 11 69455973 nonsense probably null
R5015:Dnah2 UTSW 11 69497882 missense possibly damaging 0.89
R5049:Dnah2 UTSW 11 69448166 missense probably damaging 1.00
R5055:Dnah2 UTSW 11 69520773 missense possibly damaging 0.67
R5153:Dnah2 UTSW 11 69520933 missense possibly damaging 0.84
R5155:Dnah2 UTSW 11 69422536 missense probably damaging 1.00
R5186:Dnah2 UTSW 11 69435884 missense probably damaging 1.00
R5187:Dnah2 UTSW 11 69458920 missense probably benign 0.15
R5208:Dnah2 UTSW 11 69458920 missense probably benign 0.15
R5252:Dnah2 UTSW 11 69529469 missense probably damaging 0.98
R5296:Dnah2 UTSW 11 69458920 missense probably benign 0.15
R5298:Dnah2 UTSW 11 69458920 missense probably benign 0.15
R5299:Dnah2 UTSW 11 69458920 missense probably benign 0.15
R5301:Dnah2 UTSW 11 69458920 missense probably benign 0.15
R5324:Dnah2 UTSW 11 69457993 missense probably benign 0.07
R5350:Dnah2 UTSW 11 69516036 missense possibly damaging 0.48
R5377:Dnah2 UTSW 11 69421848 missense probably damaging 1.00
R5393:Dnah2 UTSW 11 69500857 missense probably benign
R5421:Dnah2 UTSW 11 69435636 missense probably damaging 1.00
R5452:Dnah2 UTSW 11 69524383 missense probably damaging 1.00
R5461:Dnah2 UTSW 11 69473351 critical splice donor site probably null
R5474:Dnah2 UTSW 11 69458920 missense probably benign 0.15
R5476:Dnah2 UTSW 11 69458920 missense probably benign 0.15
R5477:Dnah2 UTSW 11 69458920 missense probably benign 0.15
R5510:Dnah2 UTSW 11 69458920 missense probably benign 0.15
R5527:Dnah2 UTSW 11 69437188 nonsense probably null
R5566:Dnah2 UTSW 11 69516569 nonsense probably null
R5587:Dnah2 UTSW 11 69437242 missense probably damaging 1.00
R5628:Dnah2 UTSW 11 69458920 missense probably benign 0.15
R5688:Dnah2 UTSW 11 69458920 missense probably benign 0.15
R5690:Dnah2 UTSW 11 69491544 missense probably benign 0.15
R5711:Dnah2 UTSW 11 69435390 missense probably damaging 1.00
R5735:Dnah2 UTSW 11 69430817 missense possibly damaging 0.93
R5826:Dnah2 UTSW 11 69458920 missense probably benign 0.15
R5913:Dnah2 UTSW 11 69448430 missense probably damaging 1.00
R5914:Dnah2 UTSW 11 69458920 missense probably benign 0.15
R5960:Dnah2 UTSW 11 69458920 missense probably benign 0.15
R5961:Dnah2 UTSW 11 69431148 missense probably damaging 1.00
R5961:Dnah2 UTSW 11 69458920 missense probably benign 0.15
R5977:Dnah2 UTSW 11 69520881 missense possibly damaging 0.79
R6020:Dnah2 UTSW 11 69500839 missense probably benign
R6036:Dnah2 UTSW 11 69458920 missense probably benign 0.15
R6036:Dnah2 UTSW 11 69458920 missense probably benign 0.15
R6050:Dnah2 UTSW 11 69458920 missense probably benign 0.15
R6086:Dnah2 UTSW 11 69516008 missense probably benign 0.30
R6115:Dnah2 UTSW 11 69446649 missense probably damaging 1.00
R6123:Dnah2 UTSW 11 69518359 missense probably benign 0.29
R6159:Dnah2 UTSW 11 69458542 missense probably damaging 1.00
R6159:Dnah2 UTSW 11 69458920 missense probably benign 0.15
R6163:Dnah2 UTSW 11 69520903 nonsense probably null
R6171:Dnah2 UTSW 11 69423042 missense probably damaging 1.00
R6263:Dnah2 UTSW 11 69457412 missense probably damaging 1.00
R6298:Dnah2 UTSW 11 69491641 missense probably benign 0.25
R6352:Dnah2 UTSW 11 69448227 missense probably damaging 1.00
R6399:Dnah2 UTSW 11 69458518 missense probably damaging 0.98
R6466:Dnah2 UTSW 11 69539415 missense probably benign
R6478:Dnah2 UTSW 11 69516010 missense probably benign 0.01
R6516:Dnah2 UTSW 11 69465386 missense probably benign 0.34
R6538:Dnah2 UTSW 11 69437197 missense possibly damaging 0.87
R6802:Dnah2 UTSW 11 69423690 missense probably damaging 1.00
R6861:Dnah2 UTSW 11 69455963 missense possibly damaging 0.64
R6869:Dnah2 UTSW 11 69429471 missense probably damaging 1.00
R6894:Dnah2 UTSW 11 69484260 missense probably benign 0.12
R6935:Dnah2 UTSW 11 69421741 missense probably damaging 1.00
R7017:Dnah2 UTSW 11 69491547 nonsense probably null
R7073:Dnah2 UTSW 11 69430492 nonsense probably null
R7111:Dnah2 UTSW 11 69446753 splice site probably null
R7125:Dnah2 UTSW 11 69436182 missense probably damaging 0.99
R7137:Dnah2 UTSW 11 69491555 missense probably damaging 1.00
R7190:Dnah2 UTSW 11 69549097 utr 5 prime probably null
R7214:Dnah2 UTSW 11 69431109 missense probably damaging 1.00
R7227:Dnah2 UTSW 11 69421396 missense probably damaging 0.99
R7238:Dnah2 UTSW 11 69459146 critical splice donor site probably null
R7256:Dnah2 UTSW 11 69431094 missense probably damaging 1.00
R7267:Dnah2 UTSW 11 69500817 missense probably damaging 1.00
R7420:Dnah2 UTSW 11 69478797 missense possibly damaging 0.94
R7421:Dnah2 UTSW 11 69492805 missense probably benign 0.25
R7437:Dnah2 UTSW 11 69498627 missense probably damaging 1.00
R7461:Dnah2 UTSW 11 69548990 critical splice donor site probably null
R7473:Dnah2 UTSW 11 69491658 missense probably damaging 0.99
R7528:Dnah2 UTSW 11 69500796 missense probably damaging 0.99
R7613:Dnah2 UTSW 11 69548990 critical splice donor site probably null
R7615:Dnah2 UTSW 11 69435304 missense probably damaging 0.99
R7626:Dnah2 UTSW 11 69498685 missense probably damaging 0.99
U24488:Dnah2 UTSW 11 69483822 missense probably damaging 0.99
X0021:Dnah2 UTSW 11 69448562 missense possibly damaging 0.81
Z1088:Dnah2 UTSW 11 69430793 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGGCATTCTCCTTGAAGACCCTG -3'
(R):5'- AGGCCAATTCGCCACTCTGAAC -3'

Sequencing Primer
(F):5'- CTGCTCTCACTTGGGAGGATAAC -3'
(R):5'- GCCACTCTGAACTGCTGAAC -3'
Posted On2013-05-23