Incidental Mutation 'R0462:Hgs'
ID41408
Institutional Source Beutler Lab
Gene Symbol Hgs
Ensembl Gene ENSMUSG00000116045
Gene Name
SynonymsHrs
MMRRC Submission 038662-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.231) question?
Stock #R0462 (G1)
Quality Score144
Status Not validated
Chromosome11
Chromosomal Location120467635-120483984 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 120479144 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 413 (N413D)
Ref Sequence ENSEMBL: ENSMUSP00000101809 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026900] [ENSMUST00000106203] [ENSMUST00000106205] [ENSMUST00000140862]
Predicted Effect possibly damaging
Transcript: ENSMUST00000026900
AA Change: N413D

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000026900
Gene: ENSMUSG00000116045
AA Change: N413D

DomainStartEndE-ValueType
VHS 8 139 6.97e-63 SMART
FYVE 155 221 1.81e-31 SMART
UIM 258 277 1.81e-1 SMART
Pfam:Hrs_helical 406 500 1.2e-41 PFAM
low complexity region 637 658 N/A INTRINSIC
low complexity region 746 767 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000106203
AA Change: N413D

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000101809
Gene: ENSMUSG00000025793
AA Change: N413D

DomainStartEndE-ValueType
VHS 8 139 6.97e-63 SMART
FYVE 155 221 1.81e-31 SMART
UIM 258 277 1.81e-1 SMART
Pfam:Hrs_helical 405 500 2.2e-48 PFAM
low complexity region 724 739 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106205
AA Change: N412D

PolyPhen 2 Score 0.094 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000101811
Gene: ENSMUSG00000025793
AA Change: N412D

DomainStartEndE-ValueType
VHS 8 139 6.97e-63 SMART
FYVE 155 221 1.81e-31 SMART
UIM 258 277 1.81e-1 SMART
Pfam:Hrs_helical 404 499 2.2e-48 PFAM
low complexity region 723 738 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000135231
SMART Domains Protein: ENSMUSP00000115037
Gene: ENSMUSG00000025793

DomainStartEndE-ValueType
Pfam:Hrs_helical 112 172 9.6e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000140862
SMART Domains Protein: ENSMUSP00000119396
Gene: ENSMUSG00000025793

DomainStartEndE-ValueType
VHS 8 123 1.29e-48 SMART
FYVE 139 205 1.81e-31 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141826
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene regulates endosomal sorting and plays a critical role in the recycling and degradation of membrane receptors. The encoded protein sorts monoubiquitinated membrane proteins into the multivesicular body, targeting these proteins for lysosome-dependent degradation. [provided by RefSeq, Dec 2010]
PHENOTYPE: Mice homozygous for disruptions in this gene display embryonic lethality during organogenesis with decreased size and no embryo turning. In addition, one allele shows cardia bifida, no foregut formation, failure of chorioallantoic fusion and neural tube,somite and allantois defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700016D06Rik T A 8: 11,661,749 probably benign Het
1700022I11Rik T A 4: 42,973,429 F921I probably benign Het
9530053A07Rik A T 7: 28,137,340 D228V probably damaging Het
Aarsd1 A T 11: 101,414,091 D190E probably damaging Het
Acnat2 A G 4: 49,383,084 probably null Het
Acot10 T G 15: 20,666,626 T10P possibly damaging Het
Aldh7a1 T C 18: 56,534,214 probably null Het
Alkbh7 G A 17: 56,998,443 V87I probably benign Het
Ano2 A T 6: 125,712,275 H121L probably benign Het
Apob A T 12: 8,000,896 Y1040F probably damaging Het
Arhgap25 A T 6: 87,459,960 V636E possibly damaging Het
Atad2b A T 12: 4,941,973 T191S possibly damaging Het
Btbd9 A T 17: 30,530,217 V41D possibly damaging Het
Bzw2 G A 12: 36,124,024 R25C probably damaging Het
Carmil1 T C 13: 24,022,511 S1326G probably benign Het
Cdh18 A G 15: 23,366,885 R226G probably damaging Het
Cdh3 A G 8: 106,555,380 N800S possibly damaging Het
Cep152 A T 2: 125,583,934 V837E possibly damaging Het
Cep85 G A 4: 134,131,421 T713M possibly damaging Het
Chd7 T C 4: 8,850,821 Y1736H probably damaging Het
Chst3 T C 10: 60,186,713 E104G probably benign Het
Cic T A 7: 25,287,140 S1299T probably damaging Het
Cic C A 7: 25,287,141 S1299Y probably damaging Het
Cmah T A 13: 24,436,741 S319R possibly damaging Het
Cnbd1 A G 4: 18,895,044 F233L probably benign Het
Cpne5 T C 17: 29,176,189 E251G probably benign Het
Csf2rb2 G A 15: 78,285,173 P485L probably damaging Het
Dimt1 T C 13: 106,948,756 M70T possibly damaging Het
Dlk2 A G 17: 46,303,098 *383W probably null Het
Dnah2 G A 11: 69,459,201 R2369C probably damaging Het
Dock2 A G 11: 34,268,052 F1173L possibly damaging Het
Dok7 A G 5: 35,066,462 H115R possibly damaging Het
Dpy19l1 A G 9: 24,414,349 I720T probably benign Het
Eps8 A T 6: 137,514,311 D356E probably benign Het
Exoc1 A G 5: 76,543,617 N263D probably benign Het
Fam173b T C 15: 31,616,872 M161T probably damaging Het
Fbxl3 T C 14: 103,082,886 D375G probably damaging Het
Flg2 A T 3: 93,201,437 E257D probably benign Het
Fstl4 A G 11: 53,186,402 D662G probably benign Het
Gbp10 G T 5: 105,218,524 Q505K possibly damaging Het
Gemin2 C T 12: 59,013,519 P15S probably damaging Het
Gm14124 A G 2: 150,269,202 E604G possibly damaging Het
Grhl2 A G 15: 37,344,675 M514V probably benign Het
Il12rb2 T C 6: 67,303,610 S538G possibly damaging Het
Kdm5a A G 6: 120,402,600 D623G probably damaging Het
Kif1bp A T 10: 62,559,456 I469N probably damaging Het
Matk G T 10: 81,259,693 V116F probably damaging Het
Mcm3 T C 1: 20,805,332 T694A probably benign Het
Mctp1 C A 13: 76,801,401 H260Q probably damaging Het
Mios T A 6: 8,215,743 I313K probably benign Het
Muc4 T A 16: 32,762,536 Y2562N possibly damaging Het
Naip5 T A 13: 100,221,732 I999F probably damaging Het
Olfr128 A T 17: 37,923,776 D70V probably damaging Het
Olfr1375 A G 11: 51,048,509 Y134C probably damaging Het
Olfr68 A T 7: 103,777,563 S261T probably benign Het
Olfr749 T A 14: 50,737,097 I22L probably benign Het
Olfr834 A T 9: 18,988,902 I305F probably benign Het
Olfr965 T A 9: 39,719,410 F61Y probably benign Het
Pafah1b1 A G 11: 74,677,715 V396A probably benign Het
Pard6b T A 2: 168,087,547 I91N possibly damaging Het
Pdzd2 T C 15: 12,592,160 S133G probably damaging Het
Plcg2 T G 8: 117,585,305 S445R probably benign Het
Plekhd1 G T 12: 80,721,578 V396L probably damaging Het
Ppp4r2 A G 6: 100,866,557 D294G possibly damaging Het
Ppwd1 T C 13: 104,222,960 probably null Het
Prr22 A G 17: 56,770,551 probably benign Het
Psme4 A G 11: 30,848,117 D1370G probably damaging Het
Rac3 T A 11: 120,722,858 V86D probably damaging Het
Rnf207 T C 4: 152,313,372 S335G possibly damaging Het
Rxfp3 A G 15: 11,036,977 L103P probably damaging Het
Slc17a3 C T 13: 23,855,858 S293F probably damaging Het
Smpdl3a G T 10: 57,794,731 C17F probably benign Het
Spen A T 4: 141,473,651 I2555N probably damaging Het
Srpk2 G T 5: 23,518,426 T564K probably damaging Het
Stard4 C T 18: 33,205,149 R116H probably damaging Het
Supt7l A T 5: 31,520,296 S175R probably damaging Het
Sycp1 A T 3: 102,819,106 Y932N possibly damaging Het
Tas2r122 T C 6: 132,711,178 M251V probably benign Het
Tbx15 A T 3: 99,316,318 E274V probably damaging Het
Tex52 A G 6: 128,384,954 E298G probably benign Het
Tmem101 T C 11: 102,155,867 M59V probably benign Het
Tmem132b T C 5: 125,785,926 V665A probably damaging Het
Trim23 T C 13: 104,198,033 V347A probably damaging Het
Ush2a A G 1: 188,910,939 H4166R probably benign Het
Vmn2r101 G T 17: 19,590,169 V406L probably benign Het
Vrk3 A G 7: 44,764,200 D166G possibly damaging Het
Washc4 T A 10: 83,556,913 M259K probably benign Het
Wdr70 T C 15: 8,079,161 D167G probably benign Het
Zfp28 A T 7: 6,392,240 Q248L possibly damaging Het
Zfp39 A G 11: 58,890,406 I510T probably benign Het
Zfp710 T A 7: 80,090,341 *646R probably null Het
Zfp90 C T 8: 106,425,260 S535L possibly damaging Het
Zfp949 C T 9: 88,568,734 T119I possibly damaging Het
Other mutations in Hgs
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01118:Hgs APN 11 120475214 missense probably damaging 1.00
IGL01520:Hgs APN 11 120478348 missense probably damaging 1.00
IGL01532:Hgs APN 11 120477509 unclassified probably null
IGL02346:Hgs APN 11 120482551 missense probably damaging 0.99
IGL02808:Hgs APN 11 120469666 nonsense probably null
LCD18:Hgs UTSW 11 120469578 splice site probably benign
R0100:Hgs UTSW 11 120482852 missense possibly damaging 0.83
R0653:Hgs UTSW 11 120469078 missense probably damaging 1.00
R0719:Hgs UTSW 11 120471605 critical splice donor site probably null
R1482:Hgs UTSW 11 120480040 missense probably benign 0.09
R1757:Hgs UTSW 11 120480063 missense probably damaging 0.98
R1782:Hgs UTSW 11 120478505 missense probably damaging 1.00
R2311:Hgs UTSW 11 120479648 missense probably damaging 1.00
R4077:Hgs UTSW 11 120477376 missense probably damaging 1.00
R4078:Hgs UTSW 11 120483048 missense probably benign 0.04
R4079:Hgs UTSW 11 120483048 missense probably benign 0.04
R4094:Hgs UTSW 11 120469033 nonsense probably null
R4204:Hgs UTSW 11 120477187 missense probably damaging 1.00
R4911:Hgs UTSW 11 120477202 missense probably damaging 0.98
R6477:Hgs UTSW 11 120469655 missense probably damaging 1.00
R6816:Hgs UTSW 11 120471571 missense probably damaging 1.00
R7264:Hgs UTSW 11 120474313 missense probably benign 0.00
R7633:Hgs UTSW 11 120474302 missense probably damaging 0.98
R7807:Hgs UTSW 11 120479934 missense probably damaging 1.00
X0024:Hgs UTSW 11 120477314 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCTGCTCTGTGGACCCAGTATTC -3'
(R):5'- ATCTGTGCCAGCTTGTCCTGAAGG -3'

Sequencing Primer
(F):5'- AGTCATGCCCAGTCACAGG -3'
(R):5'- AAGAGGATAGCTCAGACCTTTC -3'
Posted On2013-05-23