Incidental Mutation 'R0463:Rsrc1'
ID41458
Institutional Source Beutler Lab
Gene Symbol Rsrc1
Ensembl Gene ENSMUSG00000034544
Gene Namearginine/serine-rich coiled-coil 1
Synonyms1200013F24Rik, SRrp53
MMRRC Submission 038663-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.118) question?
Stock #R0463 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location66981390-67358396 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 67180861 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 176 (H176L)
Ref Sequence ENSEMBL: ENSMUSP00000125468 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046542] [ENSMUST00000065047] [ENSMUST00000065074] [ENSMUST00000161726] [ENSMUST00000162036] [ENSMUST00000162693]
Predicted Effect probably damaging
Transcript: ENSMUST00000046542
AA Change: H134L

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000047077
Gene: ENSMUSG00000034544
AA Change: H134L

DomainStartEndE-ValueType
low complexity region 3 116 N/A INTRINSIC
coiled coil region 138 191 N/A INTRINSIC
low complexity region 223 236 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000065047
AA Change: H118L

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000066967
Gene: ENSMUSG00000034544
AA Change: H118L

DomainStartEndE-ValueType
low complexity region 3 109 N/A INTRINSIC
coiled coil region 122 175 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000065074
AA Change: H176L

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000066797
Gene: ENSMUSG00000034544
AA Change: H176L

DomainStartEndE-ValueType
low complexity region 3 95 N/A INTRINSIC
low complexity region 98 159 N/A INTRINSIC
coiled coil region 180 233 N/A INTRINSIC
low complexity region 265 278 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000161726
AA Change: H176L

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000124347
Gene: ENSMUSG00000034544
AA Change: H176L

DomainStartEndE-ValueType
low complexity region 3 95 N/A INTRINSIC
low complexity region 98 159 N/A INTRINSIC
coiled coil region 180 233 N/A INTRINSIC
low complexity region 265 278 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000162036
AA Change: H176L

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000125468
Gene: ENSMUSG00000034544
AA Change: H176L

DomainStartEndE-ValueType
low complexity region 3 95 N/A INTRINSIC
low complexity region 98 159 N/A INTRINSIC
coiled coil region 180 233 N/A INTRINSIC
low complexity region 265 278 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000162693
AA Change: H174L

PolyPhen 2 Score 0.916 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000125547
Gene: ENSMUSG00000034544
AA Change: H174L

DomainStartEndE-ValueType
low complexity region 3 88 N/A INTRINSIC
low complexity region 96 157 N/A INTRINSIC
coiled coil region 178 231 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the serine and arginine rich-related protein family. The encoded protein is involved in both constitutive and alternative mRNA splicing. This gene may be associated with schizophrenia. A pseudogene of this gene is located on chromosome 9. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Nov 2012]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik A G 5: 109,737,060 probably benign Het
Abcd2 C T 15: 91,159,124 M620I probably benign Het
Ada T A 2: 163,730,351 I243F probably benign Het
Adam12 T C 7: 133,974,416 probably null Het
Adarb2 A T 13: 8,203,188 probably benign Het
Adk A C 14: 21,423,536 Q287P probably benign Het
Ahnak A G 19: 9,009,407 probably benign Het
Aoc3 C T 11: 101,331,606 R223W probably damaging Het
Aqp11 T C 7: 97,729,021 D229G probably benign Het
Arhgap28 A G 17: 67,896,225 S78P probably damaging Het
Bfsp2 T A 9: 103,426,655 E383D possibly damaging Het
Bmpr1b A T 3: 141,857,430 V251D possibly damaging Het
Calhm1 C T 19: 47,143,841 V112I probably benign Het
Catsperd A G 17: 56,659,554 D508G probably damaging Het
Cfap54 A G 10: 92,874,943 probably null Het
Cfap70 A T 14: 20,448,563 Y19N probably damaging Het
Chga A T 12: 102,562,951 R396* probably null Het
Cntnap3 T C 13: 64,778,876 E560G probably damaging Het
Csmd1 T C 8: 15,921,759 T3024A probably damaging Het
Csrnp1 CCCTCCTCCTCCTCCTCCTC CCCTCCTCCTCCTCCTC 9: 119,972,775 probably benign Het
Cysltr1 A G X: 106,578,655 V75A possibly damaging Het
Dnah2 A T 11: 69,423,126 M4140K probably damaging Het
Dph5 A G 3: 115,928,703 S277G probably benign Het
Eftud2 A T 11: 102,864,771 D203E probably damaging Het
Egf A G 3: 129,706,233 Y252H probably benign Het
Egf A G 3: 129,737,549 S126P probably damaging Het
Faf1 C T 4: 109,890,941 A481V probably benign Het
Fat2 A T 11: 55,262,829 V3519D probably damaging Het
Fbln7 C A 2: 128,877,511 A76E probably benign Het
Galnt1 A T 18: 24,254,525 K49N probably benign Het
Glb1 ACCC ACC 9: 114,421,744 probably null Het
Grk1 T C 8: 13,409,279 Y277H probably damaging Het
Hap1 A G 11: 100,349,305 L555P probably damaging Het
Ier3 T C 17: 35,822,108 I94T possibly damaging Het
Il11 T C 7: 4,776,024 T36A probably damaging Het
Il5ra A T 6: 106,731,890 D296E probably damaging Het
Itk A T 11: 46,331,989 V551E probably damaging Het
Kcna2 T A 3: 107,105,160 D352E probably benign Het
Kif5a A T 10: 127,235,652 S776T probably benign Het
Klrb1c T C 6: 128,780,403 E233G probably benign Het
Kpna7 T C 5: 145,007,994 K12R possibly damaging Het
Lhpp C T 7: 132,610,677 probably benign Het
Lhx8 A T 3: 154,328,171 probably null Het
Lrrc6 T A 15: 66,380,474 M448L probably benign Het
Magel2 T A 7: 62,378,030 H227Q possibly damaging Het
Man1a A G 10: 54,074,498 V176A probably damaging Het
Mapkbp1 T A 2: 120,023,151 M1152K probably benign Het
Mcoln3 T A 3: 146,140,576 L547* probably null Het
Myof T C 19: 37,916,504 D1624G probably damaging Het
Myom2 T C 8: 15,104,123 V687A probably benign Het
Nav1 C A 1: 135,452,207 V1586F possibly damaging Het
Ndufb8 T C 19: 44,550,345 E179G possibly damaging Het
Nfam1 T C 15: 83,001,483 T223A probably damaging Het
Nrcam T A 12: 44,551,341 V371E probably damaging Het
Nup210l A G 3: 90,180,211 Q1097R probably null Het
Obox5 T A 7: 15,757,646 M37K probably damaging Het
Obscn A T 11: 59,061,530 N4270K probably benign Het
Olfr1008 T C 2: 85,689,839 S137P possibly damaging Het
Olfr463 G A 11: 87,893,196 H243Y probably damaging Het
Olfr802 A G 10: 129,681,839 M300T probably benign Het
Olfr893 G A 9: 38,209,064 A2T probably benign Het
Olfr995 T A 2: 85,438,286 S291C probably damaging Het
Patj G A 4: 98,674,308 E1505K probably damaging Het
Pnliprp1 T A 19: 58,738,196 Y328* probably null Het
Ppp1r36 G A 12: 76,418,967 E43K probably damaging Het
Ptch1 C T 13: 63,520,307 V939I probably damaging Het
Rgs22 C A 15: 36,092,938 K396N probably damaging Het
Ryr3 A T 2: 112,661,701 F3743L probably damaging Het
Scn7a C T 2: 66,675,740 G1602R probably benign Het
Sftpc A T 14: 70,522,670 V49E probably damaging Het
Slc16a10 A G 10: 40,040,616 V430A probably benign Het
Slco4c1 A C 1: 96,867,920 S138A possibly damaging Het
Snd1 T C 6: 28,724,956 I501T probably benign Het
Stxbp2 T A 8: 3,632,559 D49E probably damaging Het
Sytl4 A T X: 133,962,187 D16E probably benign Het
Tbc1d9b G A 11: 50,145,067 G130E probably benign Het
Tdrd6 T A 17: 43,625,561 D1532V probably damaging Het
Tekt1 T C 11: 72,351,952 D243G probably damaging Het
Tet2 A G 3: 133,486,666 L669S possibly damaging Het
Tnnt3 A G 7: 142,512,335 N201S probably benign Het
Trdn A G 10: 33,466,421 probably null Het
Trim36 T C 18: 46,178,456 E259G possibly damaging Het
Trpm1 C T 7: 64,220,254 P436S probably benign Het
Vmn1r183 T A 7: 24,055,501 L243Q probably damaging Het
Vps13b T C 15: 35,597,409 S1032P probably damaging Het
Vps37d T C 5: 135,076,541 E76G probably damaging Het
Vps72 A G 3: 95,121,304 H202R probably benign Het
Wdr75 T C 1: 45,819,602 S644P probably damaging Het
Wrn T A 8: 33,280,815 E697V possibly damaging Het
Xirp2 A G 2: 67,514,918 D2501G probably benign Het
Zfp472 T C 17: 32,975,962 W24R probably damaging Het
Zmym6 T C 4: 127,122,772 V782A probably damaging Het
Other mutations in Rsrc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00499:Rsrc1 APN 3 67082600 intron probably benign
IGL03180:Rsrc1 APN 3 67082543 intron probably benign
R0200:Rsrc1 UTSW 3 67180861 missense probably damaging 0.99
R1175:Rsrc1 UTSW 3 67356218 splice site probably benign
R1293:Rsrc1 UTSW 3 67356279 missense probably damaging 1.00
R1677:Rsrc1 UTSW 3 67355475 missense probably damaging 0.97
R1981:Rsrc1 UTSW 3 67350005 missense probably benign 0.18
R2039:Rsrc1 UTSW 3 66994618 missense unknown
R4222:Rsrc1 UTSW 3 66994567 missense unknown
R4624:Rsrc1 UTSW 3 67349978 missense probably damaging 1.00
R4852:Rsrc1 UTSW 3 67355602 missense probably damaging 1.00
R6102:Rsrc1 UTSW 3 66994649 missense unknown
R6103:Rsrc1 UTSW 3 66994649 missense unknown
R6104:Rsrc1 UTSW 3 66994649 missense unknown
R6127:Rsrc1 UTSW 3 66994649 missense unknown
R6129:Rsrc1 UTSW 3 66994649 missense unknown
R6153:Rsrc1 UTSW 3 67355562 missense probably benign 0.33
R6409:Rsrc1 UTSW 3 66994649 missense unknown
R6410:Rsrc1 UTSW 3 66994649 missense unknown
R6411:Rsrc1 UTSW 3 66994649 missense unknown
R6412:Rsrc1 UTSW 3 66994649 missense unknown
R6422:Rsrc1 UTSW 3 66994649 missense unknown
R6424:Rsrc1 UTSW 3 66994649 missense unknown
R6442:Rsrc1 UTSW 3 66994649 missense unknown
R6487:Rsrc1 UTSW 3 66994649 missense unknown
R6899:Rsrc1 UTSW 3 66994649 missense unknown
R6910:Rsrc1 UTSW 3 66994649 missense unknown
R6911:Rsrc1 UTSW 3 66994649 missense unknown
R6912:Rsrc1 UTSW 3 66994649 missense unknown
R6916:Rsrc1 UTSW 3 66994649 missense unknown
R6917:Rsrc1 UTSW 3 66994649 missense unknown
R6930:Rsrc1 UTSW 3 66994649 missense unknown
R6931:Rsrc1 UTSW 3 66994649 missense unknown
R6994:Rsrc1 UTSW 3 66994649 missense unknown
R6995:Rsrc1 UTSW 3 66994649 missense unknown
R6997:Rsrc1 UTSW 3 66994649 missense unknown
R7010:Rsrc1 UTSW 3 66994649 missense unknown
R7015:Rsrc1 UTSW 3 66994649 missense unknown
R7048:Rsrc1 UTSW 3 67180831 missense probably damaging 0.99
R7078:Rsrc1 UTSW 3 66994654 missense unknown
Z1176:Rsrc1 UTSW 3 67349982 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGCAGCAATGTAACTAAACGTACTGTG -3'
(R):5'- TGCAAAGCTGTTAAATGGCTGACAC -3'

Sequencing Primer
(F):5'- GAAAATGTTGGTGGAAAATTTCTCC -3'
(R):5'- TGTTAAATGGCTGACACACACC -3'
Posted On2013-05-23