Incidental Mutation 'R0463:Faf1'
ID41470
Institutional Source Beutler Lab
Gene Symbol Faf1
Ensembl Gene ENSMUSG00000010517
Gene NameFas-associated factor 1
SynonymsDffrx, Fam
MMRRC Submission 038663-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0463 (G1)
Quality Score220
Status Not validated
Chromosome4
Chromosomal Location109676588-109963960 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 109890941 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 481 (A481V)
Ref Sequence ENSEMBL: ENSMUSP00000099785 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102724]
Predicted Effect probably benign
Transcript: ENSMUST00000102724
AA Change: A481V

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000099785
Gene: ENSMUSG00000010517
AA Change: A481V

DomainStartEndE-ValueType
Pfam:UBA_4 8 43 2.5e-10 PFAM
low complexity region 68 82 N/A INTRINSIC
internal_repeat_1 109 155 3.24e-5 PROSPERO
low complexity region 174 180 N/A INTRINSIC
internal_repeat_1 204 250 3.24e-5 PROSPERO
UAS 335 480 3.79e-69 SMART
coiled coil region 496 560 N/A INTRINSIC
UBX 565 647 2.32e-33 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155204
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Interaction of Fas ligand (TNFSF6) with the FAS antigen (TNFRSF6) mediates programmed cell death, also called apoptosis, in a number of organ systems. The protein encoded by this gene binds to FAS antigen and can initiate apoptosis or enhance apoptosis initiated through FAS antigen. Initiation of apoptosis by the protein encoded by this gene requires a ubiquitin-like domain but not the FAS-binding domain. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous fail to develop beyond 2-cell stage. Mice homozygous for a hypomorphic gene trap allele exhibit decreased susceptibility to dopaminergic neuron neurotoxicity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik A G 5: 109,737,060 probably benign Het
Abcd2 C T 15: 91,159,124 M620I probably benign Het
Ada T A 2: 163,730,351 I243F probably benign Het
Adam12 T C 7: 133,974,416 probably null Het
Adarb2 A T 13: 8,203,188 probably benign Het
Adk A C 14: 21,423,536 Q287P probably benign Het
Ahnak A G 19: 9,009,407 probably benign Het
Aoc3 C T 11: 101,331,606 R223W probably damaging Het
Aqp11 T C 7: 97,729,021 D229G probably benign Het
Arhgap28 A G 17: 67,896,225 S78P probably damaging Het
Bfsp2 T A 9: 103,426,655 E383D possibly damaging Het
Bmpr1b A T 3: 141,857,430 V251D possibly damaging Het
Calhm1 C T 19: 47,143,841 V112I probably benign Het
Catsperd A G 17: 56,659,554 D508G probably damaging Het
Cfap54 A G 10: 92,874,943 probably null Het
Cfap70 A T 14: 20,448,563 Y19N probably damaging Het
Chga A T 12: 102,562,951 R396* probably null Het
Cntnap3 T C 13: 64,778,876 E560G probably damaging Het
Csmd1 T C 8: 15,921,759 T3024A probably damaging Het
Csrnp1 CCCTCCTCCTCCTCCTCCTC CCCTCCTCCTCCTCCTC 9: 119,972,775 probably benign Het
Cysltr1 A G X: 106,578,655 V75A possibly damaging Het
Dnah2 A T 11: 69,423,126 M4140K probably damaging Het
Dph5 A G 3: 115,928,703 S277G probably benign Het
Eftud2 A T 11: 102,864,771 D203E probably damaging Het
Egf A G 3: 129,706,233 Y252H probably benign Het
Egf A G 3: 129,737,549 S126P probably damaging Het
Fat2 A T 11: 55,262,829 V3519D probably damaging Het
Fbln7 C A 2: 128,877,511 A76E probably benign Het
Galnt1 A T 18: 24,254,525 K49N probably benign Het
Glb1 ACCC ACC 9: 114,421,744 probably null Het
Grk1 T C 8: 13,409,279 Y277H probably damaging Het
Hap1 A G 11: 100,349,305 L555P probably damaging Het
Ier3 T C 17: 35,822,108 I94T possibly damaging Het
Il11 T C 7: 4,776,024 T36A probably damaging Het
Il5ra A T 6: 106,731,890 D296E probably damaging Het
Itk A T 11: 46,331,989 V551E probably damaging Het
Kcna2 T A 3: 107,105,160 D352E probably benign Het
Kif5a A T 10: 127,235,652 S776T probably benign Het
Klrb1c T C 6: 128,780,403 E233G probably benign Het
Kpna7 T C 5: 145,007,994 K12R possibly damaging Het
Lhpp C T 7: 132,610,677 probably benign Het
Lhx8 A T 3: 154,328,171 probably null Het
Lrrc6 T A 15: 66,380,474 M448L probably benign Het
Magel2 T A 7: 62,378,030 H227Q possibly damaging Het
Man1a A G 10: 54,074,498 V176A probably damaging Het
Mapkbp1 T A 2: 120,023,151 M1152K probably benign Het
Mcoln3 T A 3: 146,140,576 L547* probably null Het
Myof T C 19: 37,916,504 D1624G probably damaging Het
Myom2 T C 8: 15,104,123 V687A probably benign Het
Nav1 C A 1: 135,452,207 V1586F possibly damaging Het
Ndufb8 T C 19: 44,550,345 E179G possibly damaging Het
Nfam1 T C 15: 83,001,483 T223A probably damaging Het
Nrcam T A 12: 44,551,341 V371E probably damaging Het
Nup210l A G 3: 90,180,211 Q1097R probably null Het
Obox5 T A 7: 15,757,646 M37K probably damaging Het
Obscn A T 11: 59,061,530 N4270K probably benign Het
Olfr1008 T C 2: 85,689,839 S137P possibly damaging Het
Olfr463 G A 11: 87,893,196 H243Y probably damaging Het
Olfr802 A G 10: 129,681,839 M300T probably benign Het
Olfr893 G A 9: 38,209,064 A2T probably benign Het
Olfr995 T A 2: 85,438,286 S291C probably damaging Het
Patj G A 4: 98,674,308 E1505K probably damaging Het
Pnliprp1 T A 19: 58,738,196 Y328* probably null Het
Ppp1r36 G A 12: 76,418,967 E43K probably damaging Het
Ptch1 C T 13: 63,520,307 V939I probably damaging Het
Rgs22 C A 15: 36,092,938 K396N probably damaging Het
Rsrc1 A T 3: 67,180,861 H176L probably damaging Het
Ryr3 A T 2: 112,661,701 F3743L probably damaging Het
Scn7a C T 2: 66,675,740 G1602R probably benign Het
Sftpc A T 14: 70,522,670 V49E probably damaging Het
Slc16a10 A G 10: 40,040,616 V430A probably benign Het
Slco4c1 A C 1: 96,867,920 S138A possibly damaging Het
Snd1 T C 6: 28,724,956 I501T probably benign Het
Stxbp2 T A 8: 3,632,559 D49E probably damaging Het
Sytl4 A T X: 133,962,187 D16E probably benign Het
Tbc1d9b G A 11: 50,145,067 G130E probably benign Het
Tdrd6 T A 17: 43,625,561 D1532V probably damaging Het
Tekt1 T C 11: 72,351,952 D243G probably damaging Het
Tet2 A G 3: 133,486,666 L669S possibly damaging Het
Tnnt3 A G 7: 142,512,335 N201S probably benign Het
Trdn A G 10: 33,466,421 probably null Het
Trim36 T C 18: 46,178,456 E259G possibly damaging Het
Trpm1 C T 7: 64,220,254 P436S probably benign Het
Vmn1r183 T A 7: 24,055,501 L243Q probably damaging Het
Vps13b T C 15: 35,597,409 S1032P probably damaging Het
Vps37d T C 5: 135,076,541 E76G probably damaging Het
Vps72 A G 3: 95,121,304 H202R probably benign Het
Wdr75 T C 1: 45,819,602 S644P probably damaging Het
Wrn T A 8: 33,280,815 E697V possibly damaging Het
Xirp2 A G 2: 67,514,918 D2501G probably benign Het
Zfp472 T C 17: 32,975,962 W24R probably damaging Het
Zmym6 T C 4: 127,122,772 V782A probably damaging Het
Other mutations in Faf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00519:Faf1 APN 4 109840381 missense probably benign 0.10
IGL00569:Faf1 APN 4 109961880 makesense probably null
IGL01398:Faf1 APN 4 109736596 missense probably damaging 0.99
IGL01640:Faf1 APN 4 109840403 missense probably damaging 1.00
IGL01739:Faf1 APN 4 109677081 splice site probably benign
IGL02265:Faf1 APN 4 109742904 missense probably benign 0.00
IGL02372:Faf1 APN 4 109935582 missense probably benign 0.17
IGL02999:Faf1 APN 4 109861893 missense probably benign 0.01
R0058:Faf1 UTSW 4 109736624 missense probably benign 0.00
R0058:Faf1 UTSW 4 109736624 missense probably benign 0.00
R0098:Faf1 UTSW 4 109935499 missense probably damaging 0.99
R0098:Faf1 UTSW 4 109935499 missense probably damaging 0.99
R0183:Faf1 UTSW 4 109935610 missense probably benign
R0505:Faf1 UTSW 4 109840403 missense possibly damaging 0.91
R0755:Faf1 UTSW 4 109961839 missense probably benign 0.00
R1705:Faf1 UTSW 4 109677002 start gained probably benign
R2061:Faf1 UTSW 4 109710808 missense probably damaging 1.00
R2132:Faf1 UTSW 4 109710845 missense probably damaging 1.00
R2133:Faf1 UTSW 4 109710845 missense probably damaging 1.00
R2696:Faf1 UTSW 4 109841328 missense possibly damaging 0.92
R3937:Faf1 UTSW 4 109757692 splice site probably benign
R3939:Faf1 UTSW 4 109861879 missense probably damaging 1.00
R4602:Faf1 UTSW 4 109727428 missense probably benign
R4727:Faf1 UTSW 4 109840367 missense probably damaging 0.96
R4860:Faf1 UTSW 4 109742896 missense probably damaging 0.99
R4860:Faf1 UTSW 4 109742896 missense probably damaging 0.99
R4896:Faf1 UTSW 4 109842299 missense probably benign 0.02
R4913:Faf1 UTSW 4 109935549 missense possibly damaging 0.96
R5688:Faf1 UTSW 4 109794813 missense probably damaging 1.00
R5721:Faf1 UTSW 4 109935666 missense probably benign 0.34
R5905:Faf1 UTSW 4 109890929 missense probably benign 0.03
R6190:Faf1 UTSW 4 109861815 missense probably damaging 0.97
R6364:Faf1 UTSW 4 109961800 missense possibly damaging 0.46
R6454:Faf1 UTSW 4 109842334 missense probably benign 0.27
R6805:Faf1 UTSW 4 109861852 missense probably damaging 1.00
R7101:Faf1 UTSW 4 109925956 missense probably benign 0.12
R7381:Faf1 UTSW 4 109861937 missense probably damaging 0.99
R7392:Faf1 UTSW 4 109794843 missense probably benign 0.01
R7584:Faf1 UTSW 4 109925957 missense probably damaging 0.99
R7660:Faf1 UTSW 4 109861837 missense probably damaging 0.98
R7678:Faf1 UTSW 4 109829864 missense probably benign 0.00
R7715:Faf1 UTSW 4 109710814 missense probably damaging 0.99
R7721:Faf1 UTSW 4 109736597 missense probably damaging 1.00
Z1176:Faf1 UTSW 4 109840356 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTCTTTTGAACCTCATGACTTGGACA -3'
(R):5'- ACTGGCATTACAGGACCTTGACAAATC -3'

Sequencing Primer
(F):5'- GAACCTCATGACTTGGACATTCTTC -3'
(R):5'- AGTCACTCATCACCATTGGC -3'
Posted On2013-05-23