Mutagenetix > Incidental Mutation

Incidental Mutation 'R0463:Trpm1'

41483

Institutional Source

Beutler Lab

Gene Symbol

Trpm1

Ensembl Gene

ENSMUSG00000030523

Gene Name

transient receptor potential cation channel, subfamily M, member 1

Synonyms

Mlsn1, 4732499L03Rik, LTRPC1, melastatin

MMRRC Submission

038663-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0463 (G1)

Quality Score

210

Status

Not validated

Chromosome

Chromosomal Location

64153835-64269775 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 64220254 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Proline to Serine at position 436 (P436S)

Ref Sequence

ENSEMBL: ENSMUSP00000134947 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000085222] [ENSMUST00000177102] [ENSMUST00000205348] [ENSMUST00000205731] [ENSMUST00000205994] [ENSMUST00000206263] [ENSMUST00000206277] [ENSMUST00000206314] [ENSMUST00000206706]

AlphaFold

Q2TV84

Predicted Effect

probably benign
Transcript: ENSMUST00000085222
AA Change: P552S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000082318
Gene: ENSMUSG00000030523
AA Change: P552S

Domain	Start	End	E-Value	Type
low complexity region	8	28	N/A	INTRINSIC
low complexity region	183	195	N/A	INTRINSIC
low complexity region	289	307	N/A	INTRINSIC
low complexity region	456	491	N/A	INTRINSIC
Blast:ANK	505	533	1e-5	BLAST
low complexity region	621	650	N/A	INTRINSIC
low complexity region	823	835	N/A	INTRINSIC
transmembrane domain	876	895	N/A	INTRINSIC
Pfam:Ion_trans	907	1120	6e-16	PFAM
transmembrane domain	1150	1167	N/A	INTRINSIC
low complexity region	1216	1225	N/A	INTRINSIC
PDB:3E7K\|H	1228	1279	1e-7	PDB

Predicted Effect

probably benign
Transcript: ENSMUST00000107525
AA Change: P552S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000103149
Gene: ENSMUSG00000030523
AA Change: P552S

Domain	Start	End	E-Value	Type
low complexity region	8	28	N/A	INTRINSIC
low complexity region	183	195	N/A	INTRINSIC
low complexity region	289	307	N/A	INTRINSIC
low complexity region	456	491	N/A	INTRINSIC
Blast:ANK	505	533	1e-5	BLAST
low complexity region	621	650	N/A	INTRINSIC
low complexity region	823	835	N/A	INTRINSIC
Pfam:Ion_trans	876	1138	7.6e-22	PFAM
transmembrane domain	1156	1173	N/A	INTRINSIC
Pfam:TRPM_tetra	1230	1285	9.4e-28	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000177102
AA Change: P436S

PolyPhen 2 Score 0.048 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000134947
Gene: ENSMUSG00000030523
AA Change: P436S

Domain	Start	End	E-Value	Type
low complexity region	67	79	N/A	INTRINSIC
low complexity region	173	191	N/A	INTRINSIC
low complexity region	340	375	N/A	INTRINSIC
Blast:ANK	389	417	1e-5	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000205348

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000205434

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000205610

Predicted Effect

probably benign
Transcript: ENSMUST00000205731

Predicted Effect

probably benign
Transcript: ENSMUST00000205994
AA Change: P60S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

Predicted Effect

probably benign
Transcript: ENSMUST00000206263
AA Change: P436S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

Predicted Effect

probably benign
Transcript: ENSMUST00000206277
AA Change: P552S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

Predicted Effect

probably benign
Transcript: ENSMUST00000206314

Predicted Effect

probably benign
Transcript: ENSMUST00000206706

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000206740

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.5%
20x: 93.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the transient receptor potential melastatin subfamily of transient receptor potential ion channels. The encoded protein is a calcium permeable cation channel that is expressed in melanocytes and may play a role in melanin synthesis. Specific mutations in this gene are the cause autosomal recessive complete congenital stationary night blindness-1C. The expression of this protein is inversely correlated with melanoma aggressiveness and as such it is used as a prognostic marker for melanoma metastasis. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous mutants have defects in rod and cone electrophysiology affecting the photoresponses. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 92 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930522L14Rik	A	G	5: 109,737,060		probably benign	Het
Abcd2	C	T	15: 91,159,124	M620I	probably benign	Het
Ada	T	A	2: 163,730,351	I243F	probably benign	Het
Adam12	T	C	7: 133,974,416		probably null	Het
Adarb2	A	T	13: 8,203,188		probably benign	Het
Adk	A	C	14: 21,423,536	Q287P	probably benign	Het
Ahnak	A	G	19: 9,009,407		probably benign	Het
Aoc3	C	T	11: 101,331,606	R223W	probably damaging	Het
Aqp11	T	C	7: 97,729,021	D229G	probably benign	Het
Arhgap28	A	G	17: 67,896,225	S78P	probably damaging	Het
Bfsp2	T	A	9: 103,426,655	E383D	possibly damaging	Het
Bmpr1b	A	T	3: 141,857,430	V251D	possibly damaging	Het
Calhm1	C	T	19: 47,143,841	V112I	probably benign	Het
Catsperd	A	G	17: 56,659,554	D508G	probably damaging	Het
Cfap54	A	G	10: 92,874,943		probably null	Het
Cfap70	A	T	14: 20,448,563	Y19N	probably damaging	Het
Chga	A	T	12: 102,562,951	R396*	probably null	Het
Cntnap3	T	C	13: 64,778,876	E560G	probably damaging	Het
Csmd1	T	C	8: 15,921,759	T3024A	probably damaging	Het
Csrnp1	CCCTCCTCCTCCTCCTCCTC	CCCTCCTCCTCCTCCTC	9: 119,972,775		probably benign	Het
Cysltr1	A	G	X: 106,578,655	V75A	possibly damaging	Het
Dnah2	A	T	11: 69,423,126	M4140K	probably damaging	Het
Dph5	A	G	3: 115,928,703	S277G	probably benign	Het
Eftud2	A	T	11: 102,864,771	D203E	probably damaging	Het
Egf	A	G	3: 129,706,233	Y252H	probably benign	Het
Egf	A	G	3: 129,737,549	S126P	probably damaging	Het
Faf1	C	T	4: 109,890,941	A481V	probably benign	Het
Fat2	A	T	11: 55,262,829	V3519D	probably damaging	Het
Fbln7	C	A	2: 128,877,511	A76E	probably benign	Het
Galnt1	A	T	18: 24,254,525	K49N	probably benign	Het
Glb1	ACCC	ACC	9: 114,421,744		probably null	Het
Grk1	T	C	8: 13,409,279	Y277H	probably damaging	Het
Hap1	A	G	11: 100,349,305	L555P	probably damaging	Het
Ier3	T	C	17: 35,822,108	I94T	possibly damaging	Het
Il11	T	C	7: 4,776,024	T36A	probably damaging	Het
Il5ra	A	T	6: 106,731,890	D296E	probably damaging	Het
Itk	A	T	11: 46,331,989	V551E	probably damaging	Het
Kcna2	T	A	3: 107,105,160	D352E	probably benign	Het
Kif5a	A	T	10: 127,235,652	S776T	probably benign	Het
Klrb1c	T	C	6: 128,780,403	E233G	probably benign	Het
Kpna7	T	C	5: 145,007,994	K12R	possibly damaging	Het
Lhpp	C	T	7: 132,610,677		probably benign	Het
Lhx8	A	T	3: 154,328,171		probably null	Het
Lrrc6	T	A	15: 66,380,474	M448L	probably benign	Het
Magel2	T	A	7: 62,378,030	H227Q	possibly damaging	Het
Man1a	A	G	10: 54,074,498	V176A	probably damaging	Het
Mapkbp1	T	A	2: 120,023,151	M1152K	probably benign	Het
Mcoln3	T	A	3: 146,140,576	L547*	probably null	Het
Myof	T	C	19: 37,916,504	D1624G	probably damaging	Het
Myom2	T	C	8: 15,104,123	V687A	probably benign	Het
Nav1	C	A	1: 135,452,207	V1586F	possibly damaging	Het
Ndufb8	T	C	19: 44,550,345	E179G	possibly damaging	Het
Nfam1	T	C	15: 83,001,483	T223A	probably damaging	Het
Nrcam	T	A	12: 44,551,341	V371E	probably damaging	Het
Nup210l	A	G	3: 90,180,211	Q1097R	probably null	Het
Obox5	T	A	7: 15,757,646	M37K	probably damaging	Het
Obscn	A	T	11: 59,061,530	N4270K	probably benign	Het
Olfr1008	T	C	2: 85,689,839	S137P	possibly damaging	Het
Olfr463	G	A	11: 87,893,196	H243Y	probably damaging	Het
Olfr802	A	G	10: 129,681,839	M300T	probably benign	Het
Olfr893	G	A	9: 38,209,064	A2T	probably benign	Het
Olfr995	T	A	2: 85,438,286	S291C	probably damaging	Het
Patj	G	A	4: 98,674,308	E1505K	probably damaging	Het
Pnliprp1	T	A	19: 58,738,196	Y328*	probably null	Het
Ppp1r36	G	A	12: 76,418,967	E43K	probably damaging	Het
Ptch1	C	T	13: 63,520,307	V939I	probably damaging	Het
Rgs22	C	A	15: 36,092,938	K396N	probably damaging	Het
Rsrc1	A	T	3: 67,180,861	H176L	probably damaging	Het
Ryr3	A	T	2: 112,661,701	F3743L	probably damaging	Het
Scn7a	C	T	2: 66,675,740	G1602R	probably benign	Het
Sftpc	A	T	14: 70,522,670	V49E	probably damaging	Het
Slc16a10	A	G	10: 40,040,616	V430A	probably benign	Het
Slco4c1	A	C	1: 96,867,920	S138A	possibly damaging	Het
Snd1	T	C	6: 28,724,956	I501T	probably benign	Het
Stxbp2	T	A	8: 3,632,559	D49E	probably damaging	Het
Sytl4	A	T	X: 133,962,187	D16E	probably benign	Het
Tbc1d9b	G	A	11: 50,145,067	G130E	probably benign	Het
Tdrd6	T	A	17: 43,625,561	D1532V	probably damaging	Het
Tekt1	T	C	11: 72,351,952	D243G	probably damaging	Het
Tet2	A	G	3: 133,486,666	L669S	possibly damaging	Het
Tnnt3	A	G	7: 142,512,335	N201S	probably benign	Het
Trdn	A	G	10: 33,466,421		probably null	Het
Trim36	T	C	18: 46,178,456	E259G	possibly damaging	Het
Vmn1r183	T	A	7: 24,055,501	L243Q	probably damaging	Het
Vps13b	T	C	15: 35,597,409	S1032P	probably damaging	Het
Vps37d	T	C	5: 135,076,541	E76G	probably damaging	Het
Vps72	A	G	3: 95,121,304	H202R	probably benign	Het
Wdr75	T	C	1: 45,819,602	S644P	probably damaging	Het
Wrn	T	A	8: 33,280,815	E697V	possibly damaging	Het
Xirp2	A	G	2: 67,514,918	D2501G	probably benign	Het
Zfp472	T	C	17: 32,975,962	W24R	probably damaging	Het
Zmym6	T	C	4: 127,122,772	V782A	probably damaging	Het

Other mutations in Trpm1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00093:Trpm1	APN	7	64243450	missense	probably damaging	1.00
IGL00465:Trpm1	APN	7	64247467	missense	possibly damaging	0.94
IGL01118:Trpm1	APN	7	64235824	missense	probably benign	0.24
IGL01148:Trpm1	APN	7	64243564	missense	probably damaging	1.00
IGL01303:Trpm1	APN	7	64210830	critical splice acceptor site	probably benign	0.00
IGL01432:Trpm1	APN	7	64235019	missense	probably benign	0.18
IGL01433:Trpm1	APN	7	64204528	missense	probably damaging	1.00
IGL01506:Trpm1	APN	7	64243581	missense	probably damaging	1.00
IGL01626:Trpm1	APN	7	64268889	missense	probably damaging	1.00
IGL01640:Trpm1	APN	7	64226897	missense	probably damaging	1.00
IGL01899:Trpm1	APN	7	64234994	missense	probably benign	0.24
IGL01959:Trpm1	APN	7	64208975	missense	possibly damaging	0.81
IGL02210:Trpm1	APN	7	64210865	missense	probably damaging	1.00
IGL02268:Trpm1	APN	7	64217614	missense	probably damaging	0.96
IGL02331:Trpm1	APN	7	64235052	missense	probably benign	0.30
IGL02334:Trpm1	APN	7	64245942	critical splice acceptor site	probably null
IGL02407:Trpm1	APN	7	64219121	missense	probably damaging	1.00
IGL02425:Trpm1	APN	7	64240427	missense	probably damaging	0.96
IGL02485:Trpm1	APN	7	64269114	missense	possibly damaging	0.52
IGL02635:Trpm1	APN	7	64199224	missense	probably benign	0.00
IGL02640:Trpm1	APN	7	64219133	missense	probably damaging	0.97
IGL02827:Trpm1	APN	7	64219160	missense	probably null	1.00
PIT4458001:Trpm1	UTSW	7	64268561	missense	possibly damaging	0.94
PIT4544001:Trpm1	UTSW	7	64199250	intron	probably benign
R0012:Trpm1	UTSW	7	64268591	missense	possibly damaging	0.88
R0014:Trpm1	UTSW	7	64248222	missense	probably damaging	1.00
R0056:Trpm1	UTSW	7	64243586	missense	probably damaging	1.00
R0445:Trpm1	UTSW	7	64244842	unclassified	probably benign
R0469:Trpm1	UTSW	7	64223758	missense	probably damaging	1.00
R0510:Trpm1	UTSW	7	64223758	missense	probably damaging	1.00
R1301:Trpm1	UTSW	7	64203053	splice site	probably null
R1397:Trpm1	UTSW	7	64217658	missense	probably damaging	1.00
R1588:Trpm1	UTSW	7	64223817	missense	possibly damaging	0.93
R1618:Trpm1	UTSW	7	64240535	missense	probably damaging	1.00
R1724:Trpm1	UTSW	7	64235821	nonsense	probably null
R1827:Trpm1	UTSW	7	64235007	missense	probably damaging	1.00
R1829:Trpm1	UTSW	7	64226782	missense	probably damaging	1.00
R1835:Trpm1	UTSW	7	64230268	missense	probably damaging	1.00
R1864:Trpm1	UTSW	7	64268016	missense	probably damaging	1.00
R1895:Trpm1	UTSW	7	64223808	missense	probably damaging	1.00
R1946:Trpm1	UTSW	7	64223808	missense	probably damaging	1.00
R1959:Trpm1	UTSW	7	64230230	missense	probably damaging	1.00
R1960:Trpm1	UTSW	7	64230230	missense	probably damaging	1.00
R1980:Trpm1	UTSW	7	64208434	missense	possibly damaging	0.83
R1989:Trpm1	UTSW	7	64209032	intron	probably null
R2054:Trpm1	UTSW	7	64240555	missense	possibly damaging	0.69
R2156:Trpm1	UTSW	7	64234988	missense	probably damaging	1.00
R2251:Trpm1	UTSW	7	64209976	missense	probably damaging	1.00
R3051:Trpm1	UTSW	7	64269101	missense	probably damaging	1.00
R3148:Trpm1	UTSW	7	64235012	missense	probably benign	0.00
R3195:Trpm1	UTSW	7	64199313	nonsense	probably null
R3615:Trpm1	UTSW	7	64243570	missense	probably damaging	1.00
R3616:Trpm1	UTSW	7	64243570	missense	probably damaging	1.00
R3623:Trpm1	UTSW	7	64244853	missense	probably damaging	1.00
R3624:Trpm1	UTSW	7	64244853	missense	probably damaging	1.00
R3721:Trpm1	UTSW	7	64217727	intron	probably benign
R3822:Trpm1	UTSW	7	64217703	intron	probably benign
R4441:Trpm1	UTSW	7	64201918	missense	probably damaging	1.00
R4490:Trpm1	UTSW	7	64208912	nonsense	probably null
R4666:Trpm1	UTSW	7	64203034	missense	probably damaging	1.00
R4701:Trpm1	UTSW	7	64243500	missense	probably damaging	1.00
R4781:Trpm1	UTSW	7	64235052	missense	probably benign	0.30
R4811:Trpm1	UTSW	7	64208306	missense	probably damaging	1.00
R5017:Trpm1	UTSW	7	64244832	unclassified	probably benign
R5030:Trpm1	UTSW	7	64235831	missense	probably damaging	1.00
R5195:Trpm1	UTSW	7	64237693	missense	possibly damaging	0.84
R5238:Trpm1	UTSW	7	64268954	missense	probably damaging	1.00
R5304:Trpm1	UTSW	7	64208946	missense	probably benign	0.00
R5575:Trpm1	UTSW	7	64220270	missense	possibly damaging	0.95
R5613:Trpm1	UTSW	7	64208411	missense	probably damaging	1.00
R5855:Trpm1	UTSW	7	64268962	nonsense	probably null
R5947:Trpm1	UTSW	7	64223799	missense	probably benign	0.07
R5988:Trpm1	UTSW	7	64226805	missense	probably benign	0.16
R6054:Trpm1	UTSW	7	64268702	missense	probably benign	0.00
R6088:Trpm1	UTSW	7	64267976	missense	probably damaging	0.98
R6259:Trpm1	UTSW	7	64268478	missense	possibly damaging	0.47
R6379:Trpm1	UTSW	7	64199194	missense	probably benign	0.00
R6380:Trpm1	UTSW	7	64268297	missense	probably benign	0.24
R6429:Trpm1	UTSW	7	64268504	missense	probably benign	0.00
R6600:Trpm1	UTSW	7	64154033	start codon destroyed	probably null	0.56
R6622:Trpm1	UTSW	7	64240595	missense	probably damaging	0.96
R6939:Trpm1	UTSW	7	64268297	missense	probably benign	0.03
R6944:Trpm1	UTSW	7	64243433	missense	probably damaging	1.00
R7025:Trpm1	UTSW	7	64226714	critical splice acceptor site	probably null
R7112:Trpm1	UTSW	7	64235845	missense	probably damaging	0.97
R7168:Trpm1	UTSW	7	64268697	missense	probably benign	0.01
R7219:Trpm1	UTSW	7	64204585	missense	possibly damaging	0.68
R7224:Trpm1	UTSW	7	64219106	critical splice acceptor site	probably null
R7285:Trpm1	UTSW	7	64209981	nonsense	probably null
R7367:Trpm1	UTSW	7	64268801	missense	probably benign	0.06
R7449:Trpm1	UTSW	7	64208975	missense	probably benign	0.14
R7466:Trpm1	UTSW	7	64240582	missense	probably damaging	0.99
R7498:Trpm1	UTSW	7	64208909	missense	possibly damaging	0.93
R7581:Trpm1	UTSW	7	64204555	missense	probably benign	0.00
R7776:Trpm1	UTSW	7	64248191	missense	probably benign	0.04
R8062:Trpm1	UTSW	7	64201941	missense	probably benign	0.18
R8069:Trpm1	UTSW	7	64208970	missense	possibly damaging	0.55
R8157:Trpm1	UTSW	7	64199269	missense	probably damaging	1.00
R8219:Trpm1	UTSW	7	64201951	missense	probably benign	0.35
R8258:Trpm1	UTSW	7	64269029	missense	probably benign	0.10
R8259:Trpm1	UTSW	7	64269029	missense	probably benign	0.10
R8320:Trpm1	UTSW	7	64268793	missense	possibly damaging	0.56
R8536:Trpm1	UTSW	7	64247407	missense	probably damaging	1.00
R8544:Trpm1	UTSW	7	64224608	splice site	probably null
R8813:Trpm1	UTSW	7	64202008	missense	possibly damaging	0.68
R8912:Trpm1	UTSW	7	64268880	missense	probably benign	0.06
R8954:Trpm1	UTSW	7	64208341	missense	probably damaging	0.98
R9139:Trpm1	UTSW	7	64199195	missense	probably benign	0.00
R9205:Trpm1	UTSW	7	64240571	missense	possibly damaging	0.66
R9258:Trpm1	UTSW	7	64234965	missense	probably benign	0.01
R9283:Trpm1	UTSW	7	64223875	missense	probably benign	0.18
R9394:Trpm1	UTSW	7	64268732	missense	probably benign	0.00
R9430:Trpm1	UTSW	7	64223698	missense	probably benign	0.38
R9537:Trpm1	UTSW	7	64153868	unclassified	probably benign
R9616:Trpm1	UTSW	7	64208384	missense	probably damaging	0.99
X0026:Trpm1	UTSW	7	64268910	missense	probably benign	0.05
Z1176:Trpm1	UTSW	7	64203131	critical splice donor site	probably null
Z1176:Trpm1	UTSW	7	64204594	critical splice donor site	probably null
Z1177:Trpm1	UTSW	7	64217691	missense	unknown

Predicted Primers

PCR Primer
(F):5'- TGAGTGGGGTAACCACAGCCAG -3'
(R):5'- GGGGCAGGTATCATACCCATCCAG -3'

Sequencing Primer
(F):5'- CCACAGCCAGTTGTCTTATAAAGG -3'
(R):5'- gagcacgcacaccacag -3'

Posted On

2013-05-23