Mutagenetix > Incidental Mutation

Incidental Mutation 'R0463:Cntnap3'

41518

Institutional Source

Beutler Lab

Gene Symbol

Cntnap3

Ensembl Gene

ENSMUSG00000033063

Gene Name

contactin associated protein-like 3

Synonyms

MMRRC Submission

038663-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.073) question?

Stock #

R0463 (G1)

Quality Score

190

Status

Not validated

Chromosome

Chromosomal Location

64736182-64903955 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 64778876 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 560 (E560G)

Ref Sequence

ENSEMBL: ENSMUSP00000089140 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000091554]

AlphaFold

E9PY62

Predicted Effect

probably damaging
Transcript: ENSMUST00000091554
AA Change: E560G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000089140
Gene: ENSMUSG00000033063
AA Change: E560G

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
FA58C	33	180	4.88e-17	SMART
LamG	207	345	1.47e-11	SMART
LamG	394	525	1.43e-23	SMART
EGF	553	587	1.33e-1	SMART
FBG	590	775	6.76e-1	SMART
LamG	815	942	1.89e-32	SMART
EGF_like	963	999	6.28e1	SMART
LamG	1040	1178	9.46e-15	SMART
transmembrane domain	1245	1267	N/A	INTRINSIC

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.5%
20x: 93.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the NCP family of cell-recognition molecules. This family represents a distinct subgroup of the neurexins. NCP proteins mediate neuron-glial interactions in vertebrates and glial-glial contact in invertebrates. The protein encoded by this gene may play a role in cell recognition within the nervous system. Alternatively spliced transcript variants encoding different isoforms have been described but their biological nature has not been determined. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 92 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930522L14Rik	A	G	5: 109,737,060		probably benign	Het
Abcd2	C	T	15: 91,159,124	M620I	probably benign	Het
Ada	T	A	2: 163,730,351	I243F	probably benign	Het
Adam12	T	C	7: 133,974,416		probably null	Het
Adarb2	A	T	13: 8,203,188		probably benign	Het
Adk	A	C	14: 21,423,536	Q287P	probably benign	Het
Ahnak	A	G	19: 9,009,407		probably benign	Het
Aoc3	C	T	11: 101,331,606	R223W	probably damaging	Het
Aqp11	T	C	7: 97,729,021	D229G	probably benign	Het
Arhgap28	A	G	17: 67,896,225	S78P	probably damaging	Het
Bfsp2	T	A	9: 103,426,655	E383D	possibly damaging	Het
Bmpr1b	A	T	3: 141,857,430	V251D	possibly damaging	Het
Calhm1	C	T	19: 47,143,841	V112I	probably benign	Het
Catsperd	A	G	17: 56,659,554	D508G	probably damaging	Het
Cfap54	A	G	10: 92,874,943		probably null	Het
Cfap70	A	T	14: 20,448,563	Y19N	probably damaging	Het
Chga	A	T	12: 102,562,951	R396*	probably null	Het
Csmd1	T	C	8: 15,921,759	T3024A	probably damaging	Het
Csrnp1	CCCTCCTCCTCCTCCTCCTC	CCCTCCTCCTCCTCCTC	9: 119,972,775		probably benign	Het
Cysltr1	A	G	X: 106,578,655	V75A	possibly damaging	Het
Dnah2	A	T	11: 69,423,126	M4140K	probably damaging	Het
Dph5	A	G	3: 115,928,703	S277G	probably benign	Het
Eftud2	A	T	11: 102,864,771	D203E	probably damaging	Het
Egf	A	G	3: 129,706,233	Y252H	probably benign	Het
Egf	A	G	3: 129,737,549	S126P	probably damaging	Het
Faf1	C	T	4: 109,890,941	A481V	probably benign	Het
Fat2	A	T	11: 55,262,829	V3519D	probably damaging	Het
Fbln7	C	A	2: 128,877,511	A76E	probably benign	Het
Galnt1	A	T	18: 24,254,525	K49N	probably benign	Het
Glb1	ACCC	ACC	9: 114,421,744		probably null	Het
Grk1	T	C	8: 13,409,279	Y277H	probably damaging	Het
Hap1	A	G	11: 100,349,305	L555P	probably damaging	Het
Ier3	T	C	17: 35,822,108	I94T	possibly damaging	Het
Il11	T	C	7: 4,776,024	T36A	probably damaging	Het
Il5ra	A	T	6: 106,731,890	D296E	probably damaging	Het
Itk	A	T	11: 46,331,989	V551E	probably damaging	Het
Kcna2	T	A	3: 107,105,160	D352E	probably benign	Het
Kif5a	A	T	10: 127,235,652	S776T	probably benign	Het
Klrb1c	T	C	6: 128,780,403	E233G	probably benign	Het
Kpna7	T	C	5: 145,007,994	K12R	possibly damaging	Het
Lhpp	C	T	7: 132,610,677		probably benign	Het
Lhx8	A	T	3: 154,328,171		probably null	Het
Lrrc6	T	A	15: 66,380,474	M448L	probably benign	Het
Magel2	T	A	7: 62,378,030	H227Q	possibly damaging	Het
Man1a	A	G	10: 54,074,498	V176A	probably damaging	Het
Mapkbp1	T	A	2: 120,023,151	M1152K	probably benign	Het
Mcoln3	T	A	3: 146,140,576	L547*	probably null	Het
Myof	T	C	19: 37,916,504	D1624G	probably damaging	Het
Myom2	T	C	8: 15,104,123	V687A	probably benign	Het
Nav1	C	A	1: 135,452,207	V1586F	possibly damaging	Het
Ndufb8	T	C	19: 44,550,345	E179G	possibly damaging	Het
Nfam1	T	C	15: 83,001,483	T223A	probably damaging	Het
Nrcam	T	A	12: 44,551,341	V371E	probably damaging	Het
Nup210l	A	G	3: 90,180,211	Q1097R	probably null	Het
Obox5	T	A	7: 15,757,646	M37K	probably damaging	Het
Obscn	A	T	11: 59,061,530	N4270K	probably benign	Het
Olfr1008	T	C	2: 85,689,839	S137P	possibly damaging	Het
Olfr463	G	A	11: 87,893,196	H243Y	probably damaging	Het
Olfr802	A	G	10: 129,681,839	M300T	probably benign	Het
Olfr893	G	A	9: 38,209,064	A2T	probably benign	Het
Olfr995	T	A	2: 85,438,286	S291C	probably damaging	Het
Patj	G	A	4: 98,674,308	E1505K	probably damaging	Het
Pnliprp1	T	A	19: 58,738,196	Y328*	probably null	Het
Ppp1r36	G	A	12: 76,418,967	E43K	probably damaging	Het
Ptch1	C	T	13: 63,520,307	V939I	probably damaging	Het
Rgs22	C	A	15: 36,092,938	K396N	probably damaging	Het
Rsrc1	A	T	3: 67,180,861	H176L	probably damaging	Het
Ryr3	A	T	2: 112,661,701	F3743L	probably damaging	Het
Scn7a	C	T	2: 66,675,740	G1602R	probably benign	Het
Sftpc	A	T	14: 70,522,670	V49E	probably damaging	Het
Slc16a10	A	G	10: 40,040,616	V430A	probably benign	Het
Slco4c1	A	C	1: 96,867,920	S138A	possibly damaging	Het
Snd1	T	C	6: 28,724,956	I501T	probably benign	Het
Stxbp2	T	A	8: 3,632,559	D49E	probably damaging	Het
Sytl4	A	T	X: 133,962,187	D16E	probably benign	Het
Tbc1d9b	G	A	11: 50,145,067	G130E	probably benign	Het
Tdrd6	T	A	17: 43,625,561	D1532V	probably damaging	Het
Tekt1	T	C	11: 72,351,952	D243G	probably damaging	Het
Tet2	A	G	3: 133,486,666	L669S	possibly damaging	Het
Tnnt3	A	G	7: 142,512,335	N201S	probably benign	Het
Trdn	A	G	10: 33,466,421		probably null	Het
Trim36	T	C	18: 46,178,456	E259G	possibly damaging	Het
Trpm1	C	T	7: 64,220,254	P436S	probably benign	Het
Vmn1r183	T	A	7: 24,055,501	L243Q	probably damaging	Het
Vps13b	T	C	15: 35,597,409	S1032P	probably damaging	Het
Vps37d	T	C	5: 135,076,541	E76G	probably damaging	Het
Vps72	A	G	3: 95,121,304	H202R	probably benign	Het
Wdr75	T	C	1: 45,819,602	S644P	probably damaging	Het
Wrn	T	A	8: 33,280,815	E697V	possibly damaging	Het
Xirp2	A	G	2: 67,514,918	D2501G	probably benign	Het
Zfp472	T	C	17: 32,975,962	W24R	probably damaging	Het
Zmym6	T	C	4: 127,122,772	V782A	probably damaging	Het

Other mutations in Cntnap3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00433:Cntnap3	APN	13	64772731	missense	probably damaging	1.00
IGL00782:Cntnap3	APN	13	64745805	splice site	probably benign
IGL00976:Cntnap3	APN	13	64794352	missense	probably damaging	1.00
IGL01319:Cntnap3	APN	13	64787837	missense	probably damaging	1.00
IGL01610:Cntnap3	APN	13	64757301	missense	probably damaging	0.98
IGL01861:Cntnap3	APN	13	64799108	missense	probably damaging	1.00
IGL02127:Cntnap3	APN	13	64799064	splice site	probably benign
IGL02133:Cntnap3	APN	13	64751673	splice site	probably benign
IGL02251:Cntnap3	APN	13	64762036	missense	probably damaging	1.00
IGL02272:Cntnap3	APN	13	64757411	missense	probably damaging	1.00
IGL02370:Cntnap3	APN	13	64751751	missense	probably benign
IGL02456:Cntnap3	APN	13	64799058	splice site	probably benign
IGL02589:Cntnap3	APN	13	64792430	missense	probably benign	0.08
IGL02695:Cntnap3	APN	13	64772132	missense	probably benign	0.01
IGL02850:Cntnap3	APN	13	64757409	missense	probably damaging	1.00
IGL03038:Cntnap3	APN	13	64741025	missense	possibly damaging	0.50
IGL03188:Cntnap3	APN	13	64781745	missense	probably damaging	0.97
IGL03327:Cntnap3	APN	13	64887768	nonsense	probably null
PIT4480001:Cntnap3	UTSW	13	64757210	missense	probably damaging	1.00
R0309:Cntnap3	UTSW	13	64757436	splice site	probably benign
R0422:Cntnap3	UTSW	13	64757285	missense	probably damaging	0.96
R0491:Cntnap3	UTSW	13	64762045	missense	probably benign	0.01
R0499:Cntnap3	UTSW	13	64858678	missense	probably benign	0.33
R0550:Cntnap3	UTSW	13	64762000	missense	possibly damaging	0.86
R0613:Cntnap3	UTSW	13	64758414	missense	probably damaging	1.00
R0666:Cntnap3	UTSW	13	64757397	missense	probably damaging	1.00
R0840:Cntnap3	UTSW	13	64787910	missense	possibly damaging	0.94
R1577:Cntnap3	UTSW	13	64758290	missense	probably damaging	1.00
R1716:Cntnap3	UTSW	13	64762002	missense	probably damaging	1.00
R1732:Cntnap3	UTSW	13	64740812	critical splice donor site	probably null
R1739:Cntnap3	UTSW	13	64740592	missense	probably benign	0.17
R1905:Cntnap3	UTSW	13	64903764	missense	probably benign	0.04
R1988:Cntnap3	UTSW	13	64758390	missense	probably damaging	1.00
R2086:Cntnap3	UTSW	13	64794262	missense	possibly damaging	0.76
R3732:Cntnap3	UTSW	13	64740999	missense	possibly damaging	0.73
R3808:Cntnap3	UTSW	13	64781804	missense	probably damaging	0.96
R3809:Cntnap3	UTSW	13	64781804	missense	probably damaging	0.96
R4384:Cntnap3	UTSW	13	64748460	missense	probably damaging	1.00
R4433:Cntnap3	UTSW	13	64778853	missense	possibly damaging	0.92
R4631:Cntnap3	UTSW	13	64778883	missense	probably benign	0.04
R4645:Cntnap3	UTSW	13	64778788	critical splice donor site	probably null
R4702:Cntnap3	UTSW	13	64778862	missense	probably benign	0.17
R4876:Cntnap3	UTSW	13	64787706	missense	probably benign	0.00
R4994:Cntnap3	UTSW	13	64761984	missense	possibly damaging	0.55
R5043:Cntnap3	UTSW	13	64794348	missense	probably damaging	1.00
R5214:Cntnap3	UTSW	13	64762010	missense	probably damaging	1.00
R5403:Cntnap3	UTSW	13	64761978	missense	possibly damaging	0.90
R5571:Cntnap3	UTSW	13	64903758	missense	probably damaging	0.98
R5587:Cntnap3	UTSW	13	64746738	missense	probably damaging	1.00
R5695:Cntnap3	UTSW	13	64787955	missense	probably damaging	0.99
R5834:Cntnap3	UTSW	13	64748577	missense	probably benign	0.07
R5892:Cntnap3	UTSW	13	64799180	missense	probably damaging	1.00
R5950:Cntnap3	UTSW	13	64787769	missense	probably damaging	1.00
R6526:Cntnap3	UTSW	13	64781888	missense	possibly damaging	0.96
R6954:Cntnap3	UTSW	13	64748559	missense	probably benign	0.00
R7138:Cntnap3	UTSW	13	64781725	critical splice donor site	probably null
R7355:Cntnap3	UTSW	13	64771962	missense	probably benign
R7425:Cntnap3	UTSW	13	64758252	missense	probably damaging	1.00
R7521:Cntnap3	UTSW	13	64772001	missense	probably benign	0.22
R7719:Cntnap3	UTSW	13	64772777	nonsense	probably null
R7810:Cntnap3	UTSW	13	64793308	missense	possibly damaging	0.73
R7871:Cntnap3	UTSW	13	64903773	missense	probably benign	0.00
R8259:Cntnap3	UTSW	13	64787867	missense	probably damaging	0.99
R8415:Cntnap3	UTSW	13	64738665	missense	probably benign	0.31
R8491:Cntnap3	UTSW	13	64785343	missense	probably damaging	1.00
R9086:Cntnap3	UTSW	13	64781759	missense	probably damaging	1.00
R9087:Cntnap3	UTSW	13	64751718	missense	probably damaging	0.96
R9398:Cntnap3	UTSW	13	64903834	missense	probably benign	0.41
R9475:Cntnap3	UTSW	13	64799135	missense	probably damaging	1.00
R9625:Cntnap3	UTSW	13	64858765	missense	probably damaging	1.00
R9679:Cntnap3	UTSW	13	64751748	missense	probably damaging	1.00
Z1176:Cntnap3	UTSW	13	64740872	frame shift	probably null
Z1176:Cntnap3	UTSW	13	64792388	missense	probably damaging	0.98
Z1177:Cntnap3	UTSW	13	64781892	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- GCTATTGCTGACAAGGTTCACTTTTGC -3'
(R):5'- CAGACTCAGTGTTCACTGGTCATGC -3'

Sequencing Primer
(F):5'- gctcagtggcacagcag -3'
(R):5'- GTTCACTGGTCATGCTGAATTTTC -3'

Posted On

2013-05-23