Incidental Mutation 'R0463:Vps13b'
ID 41523
Institutional Source Beutler Lab
Gene Symbol Vps13b
Ensembl Gene ENSMUSG00000037646
Gene Name vacuolar protein sorting 13B
Synonyms 2310042E16Rik, 1810042B05Rik, Coh1, C330002D13Rik
MMRRC Submission 038663-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0463 (G1)
Quality Score 225
Status Not validated
Chromosome 15
Chromosomal Location 35371160-35931229 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 35597409 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 1032 (S1032P)
Ref Sequence ENSEMBL: ENSMUSP00000045490 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048646]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000048646
AA Change: S1032P

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000045490
Gene: ENSMUSG00000037646
AA Change: S1032P

DomainStartEndE-ValueType
Pfam:Chorein_N 2 120 1e-29 PFAM
low complexity region 128 137 N/A INTRINSIC
low complexity region 143 160 N/A INTRINSIC
low complexity region 975 984 N/A INTRINSIC
low complexity region 1007 1018 N/A INTRINSIC
low complexity region 1876 1883 N/A INTRINSIC
low complexity region 2042 2054 N/A INTRINSIC
low complexity region 2414 2423 N/A INTRINSIC
Pfam:SHR-BD 2601 2700 8.4e-10 PFAM
low complexity region 2954 2964 N/A INTRINSIC
Pfam:VPS13_C 3539 3706 2.6e-30 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226579
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a potential transmembrane protein that may function in vesicle-mediated transport and sorting of proteins within the cell. This protein may play a role in the development and the function of the eye, hematological system, and central nervous system. Mutations in this gene have been associated with Cohen syndrome. Multiple splice variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik A G 5: 109,737,060 probably benign Het
Abcd2 C T 15: 91,159,124 M620I probably benign Het
Ada T A 2: 163,730,351 I243F probably benign Het
Adam12 T C 7: 133,974,416 probably null Het
Adarb2 A T 13: 8,203,188 probably benign Het
Adk A C 14: 21,423,536 Q287P probably benign Het
Ahnak A G 19: 9,009,407 probably benign Het
Aoc3 C T 11: 101,331,606 R223W probably damaging Het
Aqp11 T C 7: 97,729,021 D229G probably benign Het
Arhgap28 A G 17: 67,896,225 S78P probably damaging Het
Bfsp2 T A 9: 103,426,655 E383D possibly damaging Het
Bmpr1b A T 3: 141,857,430 V251D possibly damaging Het
Calhm1 C T 19: 47,143,841 V112I probably benign Het
Catsperd A G 17: 56,659,554 D508G probably damaging Het
Cfap54 A G 10: 92,874,943 probably null Het
Cfap70 A T 14: 20,448,563 Y19N probably damaging Het
Chga A T 12: 102,562,951 R396* probably null Het
Cntnap3 T C 13: 64,778,876 E560G probably damaging Het
Csmd1 T C 8: 15,921,759 T3024A probably damaging Het
Csrnp1 CCCTCCTCCTCCTCCTCCTC CCCTCCTCCTCCTCCTC 9: 119,972,775 probably benign Het
Cysltr1 A G X: 106,578,655 V75A possibly damaging Het
Dnah2 A T 11: 69,423,126 M4140K probably damaging Het
Dph5 A G 3: 115,928,703 S277G probably benign Het
Eftud2 A T 11: 102,864,771 D203E probably damaging Het
Egf A G 3: 129,706,233 Y252H probably benign Het
Egf A G 3: 129,737,549 S126P probably damaging Het
Faf1 C T 4: 109,890,941 A481V probably benign Het
Fat2 A T 11: 55,262,829 V3519D probably damaging Het
Fbln7 C A 2: 128,877,511 A76E probably benign Het
Galnt1 A T 18: 24,254,525 K49N probably benign Het
Glb1 ACCC ACC 9: 114,421,744 probably null Het
Grk1 T C 8: 13,409,279 Y277H probably damaging Het
Hap1 A G 11: 100,349,305 L555P probably damaging Het
Ier3 T C 17: 35,822,108 I94T possibly damaging Het
Il11 T C 7: 4,776,024 T36A probably damaging Het
Il5ra A T 6: 106,731,890 D296E probably damaging Het
Itk A T 11: 46,331,989 V551E probably damaging Het
Kcna2 T A 3: 107,105,160 D352E probably benign Het
Kif5a A T 10: 127,235,652 S776T probably benign Het
Klrb1c T C 6: 128,780,403 E233G probably benign Het
Kpna7 T C 5: 145,007,994 K12R possibly damaging Het
Lhpp C T 7: 132,610,677 probably benign Het
Lhx8 A T 3: 154,328,171 probably null Het
Lrrc6 T A 15: 66,380,474 M448L probably benign Het
Magel2 T A 7: 62,378,030 H227Q possibly damaging Het
Man1a A G 10: 54,074,498 V176A probably damaging Het
Mapkbp1 T A 2: 120,023,151 M1152K probably benign Het
Mcoln3 T A 3: 146,140,576 L547* probably null Het
Myof T C 19: 37,916,504 D1624G probably damaging Het
Myom2 T C 8: 15,104,123 V687A probably benign Het
Nav1 C A 1: 135,452,207 V1586F possibly damaging Het
Ndufb8 T C 19: 44,550,345 E179G possibly damaging Het
Nfam1 T C 15: 83,001,483 T223A probably damaging Het
Nrcam T A 12: 44,551,341 V371E probably damaging Het
Nup210l A G 3: 90,180,211 Q1097R probably null Het
Obox5 T A 7: 15,757,646 M37K probably damaging Het
Obscn A T 11: 59,061,530 N4270K probably benign Het
Olfr1008 T C 2: 85,689,839 S137P possibly damaging Het
Olfr463 G A 11: 87,893,196 H243Y probably damaging Het
Olfr802 A G 10: 129,681,839 M300T probably benign Het
Olfr893 G A 9: 38,209,064 A2T probably benign Het
Olfr995 T A 2: 85,438,286 S291C probably damaging Het
Patj G A 4: 98,674,308 E1505K probably damaging Het
Pnliprp1 T A 19: 58,738,196 Y328* probably null Het
Ppp1r36 G A 12: 76,418,967 E43K probably damaging Het
Ptch1 C T 13: 63,520,307 V939I probably damaging Het
Rgs22 C A 15: 36,092,938 K396N probably damaging Het
Rsrc1 A T 3: 67,180,861 H176L probably damaging Het
Ryr3 A T 2: 112,661,701 F3743L probably damaging Het
Scn7a C T 2: 66,675,740 G1602R probably benign Het
Sftpc A T 14: 70,522,670 V49E probably damaging Het
Slc16a10 A G 10: 40,040,616 V430A probably benign Het
Slco4c1 A C 1: 96,867,920 S138A possibly damaging Het
Snd1 T C 6: 28,724,956 I501T probably benign Het
Stxbp2 T A 8: 3,632,559 D49E probably damaging Het
Sytl4 A T X: 133,962,187 D16E probably benign Het
Tbc1d9b G A 11: 50,145,067 G130E probably benign Het
Tdrd6 T A 17: 43,625,561 D1532V probably damaging Het
Tekt1 T C 11: 72,351,952 D243G probably damaging Het
Tet2 A G 3: 133,486,666 L669S possibly damaging Het
Tnnt3 A G 7: 142,512,335 N201S probably benign Het
Trdn A G 10: 33,466,421 probably null Het
Trim36 T C 18: 46,178,456 E259G possibly damaging Het
Trpm1 C T 7: 64,220,254 P436S probably benign Het
Vmn1r183 T A 7: 24,055,501 L243Q probably damaging Het
Vps37d T C 5: 135,076,541 E76G probably damaging Het
Vps72 A G 3: 95,121,304 H202R probably benign Het
Wdr75 T C 1: 45,819,602 S644P probably damaging Het
Wrn T A 8: 33,280,815 E697V possibly damaging Het
Xirp2 A G 2: 67,514,918 D2501G probably benign Het
Zfp472 T C 17: 32,975,962 W24R probably damaging Het
Zmym6 T C 4: 127,122,772 V782A probably damaging Het
Other mutations in Vps13b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Vps13b APN 15 35926226 missense possibly damaging 0.52
IGL00513:Vps13b APN 15 35793884 missense probably damaging 1.00
IGL00516:Vps13b APN 15 35640557 missense probably damaging 1.00
IGL00640:Vps13b APN 15 35417577 missense probably benign
IGL00753:Vps13b APN 15 35372031 missense probably damaging 0.99
IGL00784:Vps13b APN 15 35846900 missense probably damaging 1.00
IGL01138:Vps13b APN 15 35446770 splice site probably benign
IGL01349:Vps13b APN 15 35793945 missense probably benign 0.00
IGL01403:Vps13b APN 15 35709479 missense probably benign 0.00
IGL01535:Vps13b APN 15 35454957 missense possibly damaging 0.67
IGL01571:Vps13b APN 15 35877489 splice site probably benign
IGL01642:Vps13b APN 15 35792072 missense probably benign 0.43
IGL01658:Vps13b APN 15 35671333 missense probably damaging 0.99
IGL01759:Vps13b APN 15 35878789 missense probably damaging 1.00
IGL01763:Vps13b APN 15 35709799 missense possibly damaging 0.72
IGL01906:Vps13b APN 15 35639847 splice site probably benign
IGL01982:Vps13b APN 15 35438904 nonsense probably null
IGL01997:Vps13b APN 15 35709224 missense probably damaging 1.00
IGL02041:Vps13b APN 15 35423245 missense probably damaging 0.98
IGL02073:Vps13b APN 15 35875586 missense possibly damaging 0.52
IGL02077:Vps13b APN 15 35910613 missense possibly damaging 0.68
IGL02141:Vps13b APN 15 35572081 missense probably benign 0.09
IGL02146:Vps13b APN 15 35646333 missense probably benign 0.36
IGL02197:Vps13b APN 15 35930056 missense probably benign 0.02
IGL02311:Vps13b APN 15 35709514 missense probably benign 0.08
IGL02466:Vps13b APN 15 35770741 missense possibly damaging 0.86
IGL02506:Vps13b APN 15 35917162 missense probably damaging 1.00
IGL02550:Vps13b APN 15 35572096 missense probably benign
IGL02553:Vps13b APN 15 35646301 missense probably benign 0.00
IGL02674:Vps13b APN 15 35639958 missense probably benign 0.41
IGL02690:Vps13b APN 15 35917142 missense probably damaging 1.00
IGL02731:Vps13b APN 15 35917128 missense probably benign 0.00
IGL02739:Vps13b APN 15 35879900 missense probably damaging 1.00
IGL02868:Vps13b APN 15 35884519 missense probably benign 0.03
IGL03081:Vps13b APN 15 35875820 missense probably damaging 0.97
IGL03178:Vps13b APN 15 35869300 missense probably damaging 1.00
IGL03343:Vps13b APN 15 35917170 missense possibly damaging 0.76
IGL03407:Vps13b APN 15 35639866 missense possibly damaging 0.95
IGL03410:Vps13b APN 15 35910340 missense probably benign
omlette UTSW 15 35671400 missense probably benign 0.13
swiss UTSW 15 35709673 missense possibly damaging 0.80
FR4449:Vps13b UTSW 15 35846957 missense probably damaging 1.00
FR4548:Vps13b UTSW 15 35846957 missense probably damaging 1.00
FR4737:Vps13b UTSW 15 35846957 missense probably damaging 1.00
FR4976:Vps13b UTSW 15 35846957 missense probably damaging 1.00
LCD18:Vps13b UTSW 15 35846957 missense probably damaging 1.00
PIT4531001:Vps13b UTSW 15 35878825 missense probably damaging 1.00
PIT4581001:Vps13b UTSW 15 35534263 missense probably damaging 1.00
PIT4618001:Vps13b UTSW 15 35709240 missense probably damaging 1.00
R0026:Vps13b UTSW 15 35923301 missense possibly damaging 0.62
R0026:Vps13b UTSW 15 35923301 missense possibly damaging 0.62
R0108:Vps13b UTSW 15 35572119 missense probably benign 0.20
R0109:Vps13b UTSW 15 35572119 missense probably benign 0.20
R0109:Vps13b UTSW 15 35572119 missense probably benign 0.20
R0116:Vps13b UTSW 15 35423155 missense probably damaging 0.99
R0123:Vps13b UTSW 15 35887261 missense probably benign 0.01
R0124:Vps13b UTSW 15 35576528 critical splice donor site probably null
R0134:Vps13b UTSW 15 35887261 missense probably benign 0.01
R0137:Vps13b UTSW 15 35926219 missense probably benign 0.06
R0195:Vps13b UTSW 15 35471899 missense probably benign 0.00
R0225:Vps13b UTSW 15 35887261 missense probably benign 0.01
R0320:Vps13b UTSW 15 35674828 missense probably damaging 0.98
R0333:Vps13b UTSW 15 35879803 missense probably damaging 1.00
R0336:Vps13b UTSW 15 35455133 nonsense probably null
R0466:Vps13b UTSW 15 35445602 nonsense probably null
R0472:Vps13b UTSW 15 35417633 critical splice donor site probably null
R0523:Vps13b UTSW 15 35472050 missense probably benign 0.20
R0602:Vps13b UTSW 15 35422368 missense probably damaging 1.00
R0612:Vps13b UTSW 15 35623657 missense probably benign 0.12
R0627:Vps13b UTSW 15 35371999 nonsense probably null
R0679:Vps13b UTSW 15 35709703 missense possibly damaging 0.73
R0742:Vps13b UTSW 15 35794361 missense probably benign 0.22
R1053:Vps13b UTSW 15 35652363 missense probably damaging 1.00
R1355:Vps13b UTSW 15 35422454 missense probably damaging 1.00
R1386:Vps13b UTSW 15 35923312 missense probably damaging 0.99
R1403:Vps13b UTSW 15 35709122 splice site probably benign
R1453:Vps13b UTSW 15 35422444 missense probably damaging 0.97
R1464:Vps13b UTSW 15 35709484 missense probably benign 0.14
R1464:Vps13b UTSW 15 35709484 missense probably benign 0.14
R1511:Vps13b UTSW 15 35839975 missense probably damaging 0.99
R1511:Vps13b UTSW 15 35841573 missense probably benign 0.00
R1513:Vps13b UTSW 15 35438730 nonsense probably null
R1536:Vps13b UTSW 15 35875566 missense probably damaging 0.98
R1537:Vps13b UTSW 15 35792181 missense possibly damaging 0.62
R1558:Vps13b UTSW 15 35534319 missense probably damaging 1.00
R1601:Vps13b UTSW 15 35642436 missense probably benign 0.11
R1653:Vps13b UTSW 15 35607272 nonsense probably null
R1695:Vps13b UTSW 15 35576521 missense probably benign 0.05
R1760:Vps13b UTSW 15 35884619 missense possibly damaging 0.54
R1785:Vps13b UTSW 15 35879791 missense probably damaging 1.00
R1786:Vps13b UTSW 15 35879791 missense probably damaging 1.00
R1803:Vps13b UTSW 15 35430205 nonsense probably null
R1804:Vps13b UTSW 15 35917137 missense probably damaging 1.00
R1808:Vps13b UTSW 15 35792059 missense probably benign 0.00
R1817:Vps13b UTSW 15 35910642 missense possibly damaging 0.86
R1818:Vps13b UTSW 15 35877577 missense probably benign 0.00
R1836:Vps13b UTSW 15 35910232 missense probably damaging 0.99
R1850:Vps13b UTSW 15 35674959 splice site probably benign
R1884:Vps13b UTSW 15 35430291 splice site probably benign
R1938:Vps13b UTSW 15 35709507 missense probably damaging 1.00
R1955:Vps13b UTSW 15 35925408 critical splice donor site probably null
R1956:Vps13b UTSW 15 35869407 missense probably damaging 1.00
R1958:Vps13b UTSW 15 35878689 missense probably damaging 0.99
R2013:Vps13b UTSW 15 35607142 missense probably damaging 0.99
R2014:Vps13b UTSW 15 35607142 missense probably damaging 0.99
R2015:Vps13b UTSW 15 35607142 missense probably damaging 0.99
R2038:Vps13b UTSW 15 35884741 missense probably damaging 1.00
R2058:Vps13b UTSW 15 35841447 missense probably damaging 1.00
R2082:Vps13b UTSW 15 35910746 missense possibly damaging 0.70
R2087:Vps13b UTSW 15 35597493 missense probably damaging 0.99
R2124:Vps13b UTSW 15 35646080 missense probably benign 0.08
R2130:Vps13b UTSW 15 35671400 missense probably benign 0.13
R2168:Vps13b UTSW 15 35792188 missense probably damaging 1.00
R2168:Vps13b UTSW 15 35792189 missense probably damaging 1.00
R2171:Vps13b UTSW 15 35887197 missense probably benign 0.44
R2221:Vps13b UTSW 15 35884597 missense probably benign
R2263:Vps13b UTSW 15 35646181 missense probably benign 0.02
R2289:Vps13b UTSW 15 35572105 missense probably damaging 1.00
R2316:Vps13b UTSW 15 35674899 nonsense probably null
R2351:Vps13b UTSW 15 35869311 missense probably damaging 1.00
R2512:Vps13b UTSW 15 35884555 missense probably benign 0.35
R3054:Vps13b UTSW 15 35646361 missense probably damaging 0.99
R3055:Vps13b UTSW 15 35646361 missense probably damaging 0.99
R3196:Vps13b UTSW 15 35869395 missense probably damaging 1.00
R3236:Vps13b UTSW 15 35910304 missense probably benign 0.40
R3404:Vps13b UTSW 15 35926054 missense probably damaging 1.00
R3722:Vps13b UTSW 15 35671382 missense probably damaging 0.99
R4077:Vps13b UTSW 15 35455128 missense probably damaging 0.99
R4153:Vps13b UTSW 15 35792027 splice site probably null
R4224:Vps13b UTSW 15 35876419 missense probably damaging 0.99
R4408:Vps13b UTSW 15 35709294 missense probably damaging 0.98
R4431:Vps13b UTSW 15 35770753 missense probably damaging 1.00
R4449:Vps13b UTSW 15 35876793 missense possibly damaging 0.86
R4508:Vps13b UTSW 15 35709673 missense possibly damaging 0.80
R4631:Vps13b UTSW 15 35646132 missense possibly damaging 0.95
R4655:Vps13b UTSW 15 35770689 missense probably benign
R4666:Vps13b UTSW 15 35640544 missense probably benign 0.13
R4684:Vps13b UTSW 15 35646178 missense probably damaging 0.98
R4684:Vps13b UTSW 15 35841341 missense probably benign
R4684:Vps13b UTSW 15 35879821 missense probably benign
R4721:Vps13b UTSW 15 35910718 nonsense probably null
R4771:Vps13b UTSW 15 35910800 missense probably damaging 1.00
R4830:Vps13b UTSW 15 35452224 missense possibly damaging 0.94
R4835:Vps13b UTSW 15 35869372 missense probably damaging 1.00
R4835:Vps13b UTSW 15 35910293 missense probably benign
R4857:Vps13b UTSW 15 35456654 missense probably benign 0.01
R4891:Vps13b UTSW 15 35640515 splice site probably null
R5095:Vps13b UTSW 15 35923202 missense probably damaging 1.00
R5110:Vps13b UTSW 15 35770809 missense probably damaging 0.99
R5147:Vps13b UTSW 15 35456678 missense probably benign 0.32
R5153:Vps13b UTSW 15 35422453 missense probably damaging 0.99
R5257:Vps13b UTSW 15 35794421 missense possibly damaging 0.75
R5258:Vps13b UTSW 15 35794421 missense possibly damaging 0.75
R5296:Vps13b UTSW 15 35876413 missense probably damaging 1.00
R5386:Vps13b UTSW 15 35640528 critical splice acceptor site probably null
R5396:Vps13b UTSW 15 35886948 missense probably damaging 0.99
R5412:Vps13b UTSW 15 35533385 missense probably damaging 1.00
R5488:Vps13b UTSW 15 35770542 missense probably benign
R5489:Vps13b UTSW 15 35770542 missense probably benign
R5503:Vps13b UTSW 15 35452166 missense probably damaging 0.97
R5575:Vps13b UTSW 15 35929919 missense probably damaging 1.00
R5781:Vps13b UTSW 15 35794035 missense probably damaging 0.97
R5872:Vps13b UTSW 15 35869351 missense possibly damaging 0.56
R5876:Vps13b UTSW 15 35917061 missense probably damaging 0.99
R5994:Vps13b UTSW 15 35875772 missense probably damaging 1.00
R6031:Vps13b UTSW 15 35471968 missense probably damaging 1.00
R6031:Vps13b UTSW 15 35471968 missense probably damaging 1.00
R6045:Vps13b UTSW 15 35671316 missense probably damaging 0.99
R6143:Vps13b UTSW 15 35668738 missense probably damaging 0.99
R6147:Vps13b UTSW 15 35930031 missense probably benign 0.16
R6218:Vps13b UTSW 15 35770464 missense probably benign 0.00
R6447:Vps13b UTSW 15 35572126 missense probably benign 0.02
R6555:Vps13b UTSW 15 35846847 missense probably damaging 1.00
R6578:Vps13b UTSW 15 35446101 missense probably damaging 0.99
R6640:Vps13b UTSW 15 35617696 missense possibly damaging 0.93
R6645:Vps13b UTSW 15 35910305 missense probably benign 0.25
R6711:Vps13b UTSW 15 35887249 missense probably damaging 1.00
R6727:Vps13b UTSW 15 35770683 missense probably benign 0.19
R6737:Vps13b UTSW 15 35910611 missense probably damaging 1.00
R6844:Vps13b UTSW 15 35877590 missense probably benign 0.06
R6849:Vps13b UTSW 15 35905309 missense probably damaging 1.00
R6861:Vps13b UTSW 15 35576395 missense probably damaging 0.99
R6938:Vps13b UTSW 15 35423198 missense probably damaging 0.99
R6943:Vps13b UTSW 15 35448689 missense possibly damaging 0.95
R6989:Vps13b UTSW 15 35448581 missense probably benign 0.02
R7092:Vps13b UTSW 15 35640634 missense probably damaging 1.00
R7232:Vps13b UTSW 15 35877557 missense probably damaging 1.00
R7307:Vps13b UTSW 15 35841545 missense probably benign
R7400:Vps13b UTSW 15 35378900 missense probably damaging 1.00
R7414:Vps13b UTSW 15 35910827 missense probably damaging 1.00
R7497:Vps13b UTSW 15 35876697 missense probably benign 0.38
R7500:Vps13b UTSW 15 35910524 missense possibly damaging 0.74
R7603:Vps13b UTSW 15 35576439 missense probably damaging 0.98
R7605:Vps13b UTSW 15 35770646 missense probably damaging 0.97
R7849:Vps13b UTSW 15 35423232 missense probably damaging 0.99
R7984:Vps13b UTSW 15 35879913 missense probably benign
R8094:Vps13b UTSW 15 35668906 critical splice donor site probably null
R8097:Vps13b UTSW 15 35709346 missense probably benign 0.38
R8131:Vps13b UTSW 15 35372109 critical splice donor site probably null
R8139:Vps13b UTSW 15 35607272 nonsense probably null
R8174:Vps13b UTSW 15 35709310 nonsense probably null
R8225:Vps13b UTSW 15 35794382 missense probably damaging 0.99
R8239:Vps13b UTSW 15 35597404 missense probably damaging 1.00
R8244:Vps13b UTSW 15 35917203 missense probably damaging 1.00
R8303:Vps13b UTSW 15 35639917 missense probably damaging 1.00
R8311:Vps13b UTSW 15 35886954 missense probably benign 0.37
R8443:Vps13b UTSW 15 35455100 missense probably benign
R8494:Vps13b UTSW 15 35422448 missense probably damaging 0.99
R8499:Vps13b UTSW 15 35841320 missense probably damaging 1.00
R8506:Vps13b UTSW 15 35446745 missense probably benign 0.31
R8559:Vps13b UTSW 15 35876642 missense probably damaging 1.00
R8686:Vps13b UTSW 15 35925389 missense probably damaging 0.99
R8782:Vps13b UTSW 15 35422337 missense possibly damaging 0.93
R8806:Vps13b UTSW 15 35472066 critical splice donor site probably benign
R8824:Vps13b UTSW 15 35533299 missense probably damaging 0.99
R9024:Vps13b UTSW 15 35923324 missense probably damaging 0.97
R9038:Vps13b UTSW 15 35875785 missense possibly damaging 0.70
R9054:Vps13b UTSW 15 35422391 missense probably damaging 1.00
R9091:Vps13b UTSW 15 35770773 missense probably benign 0.13
R9129:Vps13b UTSW 15 35448647 missense probably damaging 1.00
R9214:Vps13b UTSW 15 35623746 missense probably damaging 0.99
R9237:Vps13b UTSW 15 35841333 missense probably damaging 1.00
R9256:Vps13b UTSW 15 35623779 missense possibly damaging 0.95
R9270:Vps13b UTSW 15 35770773 missense probably benign 0.13
R9279:Vps13b UTSW 15 35572144 missense probably damaging 0.97
R9291:Vps13b UTSW 15 35846913 missense probably damaging 1.00
R9342:Vps13b UTSW 15 35455054 missense possibly damaging 0.94
R9404:Vps13b UTSW 15 35876419 missense probably damaging 1.00
R9488:Vps13b UTSW 15 35447734 missense possibly damaging 0.77
R9509:Vps13b UTSW 15 35841311 missense possibly damaging 0.79
R9610:Vps13b UTSW 15 35642409 missense possibly damaging 0.85
R9611:Vps13b UTSW 15 35642409 missense possibly damaging 0.85
R9658:Vps13b UTSW 15 35623628 missense probably benign 0.00
R9674:Vps13b UTSW 15 35607234 missense probably damaging 0.98
R9696:Vps13b UTSW 15 35674887 missense possibly damaging 0.56
R9767:Vps13b UTSW 15 35910257 missense probably damaging 1.00
R9797:Vps13b UTSW 15 35674876 missense probably damaging 1.00
RF020:Vps13b UTSW 15 35925406 missense probably null 1.00
X0026:Vps13b UTSW 15 35910646 missense probably damaging 1.00
X0028:Vps13b UTSW 15 35709431 missense probably benign 0.00
Z1177:Vps13b UTSW 15 35668885 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTGTCGTCAGTGACTTGACTGATAGC -3'
(R):5'- AGCATAGCACCAGTGGACATGAAAC -3'

Sequencing Primer
(F):5'- TGACTGATAGCTAAGATCAGTAACCC -3'
(R):5'- TGGACATGAAACACACTACAACAATG -3'
Posted On 2013-05-23