Incidental Mutation 'R0465:Rab34'
ID41590
Institutional Source Beutler Lab
Gene Symbol Rab34
Ensembl Gene ENSMUSG00000002059
Gene NameRAB34, member RAS oncogene family
SynonymsRah1, Narr
MMRRC Submission 038665-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0465 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location78188430-78192193 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 78190511 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 67 (C67*)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002128] [ENSMUST00000056241] [ENSMUST00000060539] [ENSMUST00000078099] [ENSMUST00000108317] [ENSMUST00000108322] [ENSMUST00000150941] [ENSMUST00000207728]
Predicted Effect probably null
Transcript: ENSMUST00000002128
AA Change: C116*
SMART Domains Protein: ENSMUSP00000002128
Gene: ENSMUSG00000002059
AA Change: C116*

DomainStartEndE-ValueType
RAB 54 219 2.96e-49 SMART
Predicted Effect probably null
Transcript: ENSMUST00000056241
AA Change: C116*
SMART Domains Protein: ENSMUSP00000059769
Gene: ENSMUSG00000002059
AA Change: C116*

DomainStartEndE-ValueType
Pfam:Arf 43 205 9.5e-13 PFAM
Pfam:Miro 54 166 9.3e-17 PFAM
Pfam:MMR_HSR1 54 204 4.4e-7 PFAM
Pfam:Ras 54 210 4.8e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000060539
SMART Domains Protein: ENSMUSP00000050319
Gene: ENSMUSG00000044122

DomainStartEndE-ValueType
low complexity region 42 53 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000078099
SMART Domains Protein: ENSMUSP00000086022
Gene: ENSMUSG00000044122

DomainStartEndE-ValueType
coiled coil region 92 121 N/A INTRINSIC
low complexity region 148 161 N/A INTRINSIC
low complexity region 198 212 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108317
SMART Domains Protein: ENSMUSP00000103953
Gene: ENSMUSG00000044122

DomainStartEndE-ValueType
Blast:PA2c 33 99 2e-12 BLAST
SCOP:d1poc__ 55 102 5e-4 SMART
coiled coil region 179 208 N/A INTRINSIC
low complexity region 235 248 N/A INTRINSIC
low complexity region 285 299 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000108322
AA Change: C116*
SMART Domains Protein: ENSMUSP00000103958
Gene: ENSMUSG00000002059
AA Change: C116*

DomainStartEndE-ValueType
RAB 54 219 2.96e-49 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126864
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148603
Predicted Effect probably null
Transcript: ENSMUST00000150941
AA Change: C122*
SMART Domains Protein: ENSMUSP00000123033
Gene: ENSMUSG00000002059
AA Change: C122*

DomainStartEndE-ValueType
RAB 60 225 2.96e-49 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154542
Predicted Effect probably null
Transcript: ENSMUST00000156435
AA Change: C67*
SMART Domains Protein: ENSMUSP00000122848
Gene: ENSMUSG00000002059
AA Change: C67*

DomainStartEndE-ValueType
Pfam:Arf 1 167 4.1e-17 PFAM
Pfam:Roc 6 122 4.5e-32 PFAM
Pfam:MMR_HSR1 6 156 2.3e-8 PFAM
Pfam:Ras 6 168 1.9e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000207728
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.2%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein belonging to the RAB family of proteins, which are small GTPases involved in protein transport. This family member is a Golgi-bound member of the secretory pathway that is involved in the repositioning of lysosomes and the activation of macropinocytosis. Alternative splicing of this gene results in multiple transcript variants. An alternatively spliced transcript variant produces the nine-amino acid residue-repeats (NARR) protein, which is a functionally distinct nucleolar protein resulting from a different reading frame. [provided by RefSeq, Dec 2016]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
8030411F24Rik A G 2: 148,783,425 N93S probably benign Het
Adgre4 T A 17: 55,785,137 probably benign Het
Ankrd13a T A 5: 114,804,234 I526N probably damaging Het
Aox1 G A 1: 58,062,207 V446I probably damaging Het
Arid1b G A 17: 4,996,260 G441D possibly damaging Het
BC027072 A G 17: 71,750,160 C841R probably benign Het
Bdkrb2 A T 12: 105,591,859 N120Y possibly damaging Het
Bud31 G A 5: 145,146,586 V80I probably damaging Het
Camkmt T A 17: 85,431,522 F225L probably damaging Het
Carf T C 1: 60,131,983 M200T probably damaging Het
Carmil3 T C 14: 55,499,861 L767P probably damaging Het
Cdk14 T A 5: 5,093,019 R237S probably damaging Het
Cdx2 C A 5: 147,306,473 K170N possibly damaging Het
Cfap65 G A 1: 74,916,884 R1093C possibly damaging Het
Cnot8 T A 11: 58,114,060 V195E probably damaging Het
Copa T C 1: 172,118,305 F936S probably damaging Het
Dnaic1 T A 4: 41,629,988 probably null Het
Dsel T C 1: 111,862,262 N181S probably benign Het
Enpp7 A G 11: 118,988,781 N87S probably damaging Het
Fads1 C T 19: 10,183,065 P5L probably benign Het
G3bp1 T C 11: 55,498,626 F383L probably damaging Het
Gm12695 T C 4: 96,785,075 Y29C probably damaging Het
Gm5592 T A 7: 41,156,057 probably benign Het
Gmnc T G 16: 26,962,952 N109T probably damaging Het
Gstcd A G 3: 132,983,144 I615T probably benign Het
Hal A C 10: 93,516,284 K646Q probably benign Het
Hbs1l A G 10: 21,352,041 I472V probably null Het
Ift27 A T 15: 78,173,758 probably benign Het
Iqub A T 6: 24,503,784 I163N probably damaging Het
Isg20l2 T A 3: 87,931,680 V66E probably benign Het
Itgb4 T C 11: 115,979,756 M137T probably damaging Het
Lca5 T A 9: 83,395,867 K475* probably null Het
Lyve1 A G 7: 110,852,827 probably null Het
Map3k19 T C 1: 127,838,527 D220G probably damaging Het
Mdn1 T A 4: 32,699,204 probably benign Het
Mmp15 T C 8: 95,367,998 W167R probably damaging Het
Ms4a13 A G 19: 11,172,593 C135R probably benign Het
Myh1 A G 11: 67,210,417 H673R possibly damaging Het
Myrf G C 19: 10,218,162 T428S probably benign Het
Oas2 A G 5: 120,735,055 I645T probably damaging Het
Olfr605 A T 7: 103,442,835 F96Y possibly damaging Het
Pard3b T G 1: 62,211,718 probably benign Het
Patj T A 4: 98,535,507 probably null Het
Pkd1l3 G A 8: 109,623,663 S380N probably benign Het
Pkd1l3 C G 8: 109,623,649 D375E possibly damaging Het
Rimbp3 T C 16: 17,211,780 S1023P possibly damaging Het
Rnf148 T C 6: 23,654,685 N104S probably benign Het
Rpa1 T C 11: 75,313,095 T288A probably damaging Het
Scn9a A G 2: 66,526,996 L976P probably damaging Het
Serpina12 T A 12: 104,037,845 D176V probably benign Het
Sik1 C T 17: 31,855,022 V10I possibly damaging Het
Sntb1 C A 15: 55,749,276 R302L probably benign Het
Stambp A G 6: 83,570,339 I56T probably benign Het
Tac2 A G 10: 127,729,170 probably benign Het
Tecta A T 9: 42,359,418 I1198K possibly damaging Het
Tfip11 C T 5: 112,333,264 R369C probably benign Het
Tnpo1 A G 13: 98,884,634 I79T probably damaging Het
Ttll5 A T 12: 85,933,326 N895Y probably benign Het
Ube2u T A 4: 100,532,096 probably benign Het
Ubxn4 G A 1: 128,262,904 E256K probably benign Het
Vmn2r1 T C 3: 64,081,759 S40P possibly damaging Het
Vmn2r100 G A 17: 19,531,530 V612I probably damaging Het
Vmn2r59 G T 7: 42,046,908 H137N probably benign Het
Vsig10l T C 7: 43,467,442 V467A probably damaging Het
Vwde A G 6: 13,215,806 probably benign Het
Xrra1 T A 7: 99,879,371 D139E probably benign Het
Zc3h15 T C 2: 83,663,815 probably benign Het
Zfhx4 C T 3: 5,245,656 probably benign Het
Zscan18 A G 7: 12,775,486 probably benign Het
Other mutations in Rab34
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01552:Rab34 APN 11 78191438 missense probably damaging 1.00
IGL03180:Rab34 APN 11 78190318 missense probably damaging 1.00
R0190:Rab34 UTSW 11 78191406 missense possibly damaging 0.95
R1201:Rab34 UTSW 11 78190396 splice site probably null
R1907:Rab34 UTSW 11 78191255 missense probably damaging 1.00
R4411:Rab34 UTSW 11 78188766 unclassified probably null
R5564:Rab34 UTSW 11 78191632 missense probably damaging 1.00
R5952:Rab34 UTSW 11 78190268 unclassified probably benign
R6261:Rab34 UTSW 11 78191202 splice site probably null
R7015:Rab34 UTSW 11 78190152 missense probably damaging 1.00
R7127:Rab34 UTSW 11 78191230 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GATCCAGTTTAACAGGGTAGGCGG -3'
(R):5'- GGATGCCACGTCATTCAGGTTGAAG -3'

Sequencing Primer
(F):5'- TAGGTTCTGCAAAGACACCTTCG -3'
(R):5'- GTCATTCAGGTTGAAGACAATGATG -3'
Posted On2013-05-23