Incidental Mutation 'R0465:Enpp7'
ID41592
Institutional Source Beutler Lab
Gene Symbol Enpp7
Ensembl Gene ENSMUSG00000046697
Gene Nameectonucleotide pyrophosphatase/phosphodiesterase 7
SynonymsLOC238011, Alk-SMase
MMRRC Submission 038665-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0465 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location118988188-118992841 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 118988781 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 87 (N87S)
Ref Sequence ENSEMBL: ENSMUSP00000101880 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092373] [ENSMUST00000106273]
Predicted Effect probably benign
Transcript: ENSMUST00000092373
AA Change: N87S

PolyPhen 2 Score 0.447 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000090027
Gene: ENSMUSG00000046697
AA Change: N87S

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:Phosphodiest 30 353 2.5e-76 PFAM
Pfam:Metalloenzyme 43 272 8.7e-10 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106273
AA Change: N87S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101880
Gene: ENSMUSG00000046697
AA Change: N87S

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:Phosphodiest 30 353 3e-77 PFAM
Pfam:Metalloenzyme 41 257 5.2e-10 PFAM
Meta Mutation Damage Score 0.1313 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.2%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an intestinal alkaline sphingomyelin phosphodiesterase that converts sphingomyelin to ceramide and phosphocholine. The encoded protein is anchored in the cell membrane, and it may function to protect the intestinal mucosa from inflammation and tumorigenesis. This protein is glycosylated and also exhibits lysophosphatidylcholine hydrolase activity. [provided by RefSeq, Oct 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit intestinal epithelium hypertrophy, decreased crypt and villi width, and impaired sphingomyelin digestion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
8030411F24Rik A G 2: 148,783,425 N93S probably benign Het
Adgre4 T A 17: 55,785,137 probably benign Het
Ankrd13a T A 5: 114,804,234 I526N probably damaging Het
Aox1 G A 1: 58,062,207 V446I probably damaging Het
Arid1b G A 17: 4,996,260 G441D possibly damaging Het
BC027072 A G 17: 71,750,160 C841R probably benign Het
Bdkrb2 A T 12: 105,591,859 N120Y possibly damaging Het
Bud31 G A 5: 145,146,586 V80I probably damaging Het
Camkmt T A 17: 85,431,522 F225L probably damaging Het
Carf T C 1: 60,131,983 M200T probably damaging Het
Carmil3 T C 14: 55,499,861 L767P probably damaging Het
Cdk14 T A 5: 5,093,019 R237S probably damaging Het
Cdx2 C A 5: 147,306,473 K170N possibly damaging Het
Cfap65 G A 1: 74,916,884 R1093C possibly damaging Het
Cnot8 T A 11: 58,114,060 V195E probably damaging Het
Copa T C 1: 172,118,305 F936S probably damaging Het
Dnaic1 T A 4: 41,629,988 probably null Het
Dsel T C 1: 111,862,262 N181S probably benign Het
Fads1 C T 19: 10,183,065 P5L probably benign Het
G3bp1 T C 11: 55,498,626 F383L probably damaging Het
Gm12695 T C 4: 96,785,075 Y29C probably damaging Het
Gm5592 T A 7: 41,156,057 probably benign Het
Gmnc T G 16: 26,962,952 N109T probably damaging Het
Gstcd A G 3: 132,983,144 I615T probably benign Het
Hal A C 10: 93,516,284 K646Q probably benign Het
Hbs1l A G 10: 21,352,041 I472V probably null Het
Ift27 A T 15: 78,173,758 probably benign Het
Iqub A T 6: 24,503,784 I163N probably damaging Het
Isg20l2 T A 3: 87,931,680 V66E probably benign Het
Itgb4 T C 11: 115,979,756 M137T probably damaging Het
Lca5 T A 9: 83,395,867 K475* probably null Het
Lyve1 A G 7: 110,852,827 probably null Het
Map3k19 T C 1: 127,838,527 D220G probably damaging Het
Mdn1 T A 4: 32,699,204 probably benign Het
Mmp15 T C 8: 95,367,998 W167R probably damaging Het
Ms4a13 A G 19: 11,172,593 C135R probably benign Het
Myh1 A G 11: 67,210,417 H673R possibly damaging Het
Myrf G C 19: 10,218,162 T428S probably benign Het
Oas2 A G 5: 120,735,055 I645T probably damaging Het
Olfr605 A T 7: 103,442,835 F96Y possibly damaging Het
Pard3b T G 1: 62,211,718 probably benign Het
Patj T A 4: 98,535,507 probably null Het
Pkd1l3 G A 8: 109,623,663 S380N probably benign Het
Pkd1l3 C G 8: 109,623,649 D375E possibly damaging Het
Rab34 C A 11: 78,190,511 C67* probably null Het
Rimbp3 T C 16: 17,211,780 S1023P possibly damaging Het
Rnf148 T C 6: 23,654,685 N104S probably benign Het
Rpa1 T C 11: 75,313,095 T288A probably damaging Het
Scn9a A G 2: 66,526,996 L976P probably damaging Het
Serpina12 T A 12: 104,037,845 D176V probably benign Het
Sik1 C T 17: 31,855,022 V10I possibly damaging Het
Sntb1 C A 15: 55,749,276 R302L probably benign Het
Stambp A G 6: 83,570,339 I56T probably benign Het
Tac2 A G 10: 127,729,170 probably benign Het
Tecta A T 9: 42,359,418 I1198K possibly damaging Het
Tfip11 C T 5: 112,333,264 R369C probably benign Het
Tnpo1 A G 13: 98,884,634 I79T probably damaging Het
Ttll5 A T 12: 85,933,326 N895Y probably benign Het
Ube2u T A 4: 100,532,096 probably benign Het
Ubxn4 G A 1: 128,262,904 E256K probably benign Het
Vmn2r1 T C 3: 64,081,759 S40P possibly damaging Het
Vmn2r100 G A 17: 19,531,530 V612I probably damaging Het
Vmn2r59 G T 7: 42,046,908 H137N probably benign Het
Vsig10l T C 7: 43,467,442 V467A probably damaging Het
Vwde A G 6: 13,215,806 probably benign Het
Xrra1 T A 7: 99,879,371 D139E probably benign Het
Zc3h15 T C 2: 83,663,815 probably benign Het
Zfhx4 C T 3: 5,245,656 probably benign Het
Zscan18 A G 7: 12,775,486 probably benign Het
Other mutations in Enpp7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00793:Enpp7 APN 11 118990545 missense probably damaging 1.00
IGL02488:Enpp7 APN 11 118988814 missense probably damaging 1.00
IGL02672:Enpp7 APN 11 118992340 critical splice donor site probably null
R1718:Enpp7 UTSW 11 118990983 missense probably damaging 1.00
R2208:Enpp7 UTSW 11 118988762 splice site probably benign
R2970:Enpp7 UTSW 11 118990646 missense probably damaging 1.00
R3713:Enpp7 UTSW 11 118990518 missense probably damaging 1.00
R3967:Enpp7 UTSW 11 118991001 missense probably damaging 0.99
R5222:Enpp7 UTSW 11 118990962 missense probably benign 0.03
R5454:Enpp7 UTSW 11 118988808 missense probably benign 0.03
R5577:Enpp7 UTSW 11 118992127 missense probably benign 0.01
R7361:Enpp7 UTSW 11 118992159 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GACGGATTCCGCTGGAACTATGAC -3'
(R):5'- GGTGCCTGTATGTTACCTCACTTGG -3'

Sequencing Primer
(F):5'- GTCATTGCTCTGAAGAGACCC -3'
(R):5'- TGTGATCCAGATGGGTATGC -3'
Posted On2013-05-23