Incidental Mutation 'R0465:Rimbp3'
ID 41600
Institutional Source Beutler Lab
Gene Symbol Rimbp3
Ensembl Gene ENSMUSG00000071636
Gene Name RIMS binding protein 3
Synonyms RIM-BP3, LOC239731, LOC385766
MMRRC Submission 038665-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.247) question?
Stock # R0465 (G1)
Quality Score 225
Status Validated
Chromosome 16
Chromosomal Location 17208603-17213982 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 17211780 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 1023 (S1023P)
Ref Sequence ENSEMBL: ENSMUSP00000127909 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000169803]
AlphaFold Q3V0F0
Predicted Effect possibly damaging
Transcript: ENSMUST00000169803
AA Change: S1023P

PolyPhen 2 Score 0.864 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000127909
Gene: ENSMUSG00000071636
AA Change: S1023P

DomainStartEndE-ValueType
coiled coil region 25 56 N/A INTRINSIC
coiled coil region 84 145 N/A INTRINSIC
low complexity region 308 324 N/A INTRINSIC
coiled coil region 395 431 N/A INTRINSIC
coiled coil region 547 610 N/A INTRINSIC
low complexity region 688 701 N/A INTRINSIC
low complexity region 769 780 N/A INTRINSIC
SH3 825 888 7.58e-8 SMART
low complexity region 913 924 N/A INTRINSIC
FN3 980 1052 2.21e-3 SMART
FN3 1073 1160 1.91e1 SMART
low complexity region 1236 1243 N/A INTRINSIC
SH3 1423 1487 5.08e-2 SMART
SH3 1539 1602 5.97e-6 SMART
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.2%
Validation Efficiency 100% (71/71)
MGI Phenotype PHENOTYPE: Male mice homozygous for a null mutation display infertility with impaired spermiogenesis and defects in sperm head and flagellum morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
8030411F24Rik A G 2: 148,783,425 N93S probably benign Het
Adgre4 T A 17: 55,785,137 probably benign Het
Ankrd13a T A 5: 114,804,234 I526N probably damaging Het
Aox1 G A 1: 58,062,207 V446I probably damaging Het
Arid1b G A 17: 4,996,260 G441D possibly damaging Het
BC027072 A G 17: 71,750,160 C841R probably benign Het
Bdkrb2 A T 12: 105,591,859 N120Y possibly damaging Het
Bud31 G A 5: 145,146,586 V80I probably damaging Het
Camkmt T A 17: 85,431,522 F225L probably damaging Het
Carf T C 1: 60,131,983 M200T probably damaging Het
Carmil3 T C 14: 55,499,861 L767P probably damaging Het
Cdk14 T A 5: 5,093,019 R237S probably damaging Het
Cdx2 C A 5: 147,306,473 K170N possibly damaging Het
Cfap65 G A 1: 74,916,884 R1093C possibly damaging Het
Cnot8 T A 11: 58,114,060 V195E probably damaging Het
Copa T C 1: 172,118,305 F936S probably damaging Het
Dnaic1 T A 4: 41,629,988 probably null Het
Dsel T C 1: 111,862,262 N181S probably benign Het
Enpp7 A G 11: 118,988,781 N87S probably damaging Het
Fads1 C T 19: 10,183,065 P5L probably benign Het
G3bp1 T C 11: 55,498,626 F383L probably damaging Het
Gm12695 T C 4: 96,785,075 Y29C probably damaging Het
Gm5592 T A 7: 41,156,057 probably benign Het
Gmnc T G 16: 26,962,952 N109T probably damaging Het
Gstcd A G 3: 132,983,144 I615T probably benign Het
Hal A C 10: 93,516,284 K646Q probably benign Het
Hbs1l A G 10: 21,352,041 I472V probably null Het
Ift27 A T 15: 78,173,758 probably benign Het
Iqub A T 6: 24,503,784 I163N probably damaging Het
Isg20l2 T A 3: 87,931,680 V66E probably benign Het
Itgb4 T C 11: 115,979,756 M137T probably damaging Het
Lca5 T A 9: 83,395,867 K475* probably null Het
Lyve1 A G 7: 110,852,827 probably null Het
Map3k19 T C 1: 127,838,527 D220G probably damaging Het
Mdn1 T A 4: 32,699,204 probably benign Het
Mmp15 T C 8: 95,367,998 W167R probably damaging Het
Ms4a13 A G 19: 11,172,593 C135R probably benign Het
Myh1 A G 11: 67,210,417 H673R possibly damaging Het
Myrf G C 19: 10,218,162 T428S probably benign Het
Oas2 A G 5: 120,735,055 I645T probably damaging Het
Olfr605 A T 7: 103,442,835 F96Y possibly damaging Het
Pard3b T G 1: 62,211,718 probably benign Het
Patj T A 4: 98,535,507 probably null Het
Pkd1l3 G A 8: 109,623,663 S380N probably benign Het
Pkd1l3 C G 8: 109,623,649 D375E possibly damaging Het
Rab34 C A 11: 78,190,511 C67* probably null Het
Rnf148 T C 6: 23,654,685 N104S probably benign Het
Rpa1 T C 11: 75,313,095 T288A probably damaging Het
Scn9a A G 2: 66,526,996 L976P probably damaging Het
Serpina12 T A 12: 104,037,845 D176V probably benign Het
Sik1 C T 17: 31,855,022 V10I possibly damaging Het
Sntb1 C A 15: 55,749,276 R302L probably benign Het
Stambp A G 6: 83,570,339 I56T probably benign Het
Tac2 A G 10: 127,729,170 probably benign Het
Tecta A T 9: 42,359,418 I1198K possibly damaging Het
Tfip11 C T 5: 112,333,264 R369C probably benign Het
Tnpo1 A G 13: 98,884,634 I79T probably damaging Het
Ttll5 A T 12: 85,933,326 N895Y probably benign Het
Ube2u T A 4: 100,532,096 probably benign Het
Ubxn4 G A 1: 128,262,904 E256K probably benign Het
Vmn2r1 T C 3: 64,081,759 S40P possibly damaging Het
Vmn2r100 G A 17: 19,531,530 V612I probably damaging Het
Vmn2r59 G T 7: 42,046,908 H137N probably benign Het
Vsig10l T C 7: 43,467,442 V467A probably damaging Het
Vwde A G 6: 13,215,806 probably benign Het
Xrra1 T A 7: 99,879,371 D139E probably benign Het
Zc3h15 T C 2: 83,663,815 probably benign Het
Zfhx4 C T 3: 5,245,656 probably benign Het
Zscan18 A G 7: 12,775,486 probably benign Het
Other mutations in Rimbp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Rimbp3 APN 16 17209743 missense probably benign 0.01
IGL00786:Rimbp3 APN 16 17211688 missense probably damaging 0.99
IGL01411:Rimbp3 APN 16 17211094 missense probably damaging 1.00
IGL01434:Rimbp3 APN 16 17211702 missense probably benign 0.13
IGL01895:Rimbp3 APN 16 17211436 missense probably damaging 0.99
IGL02322:Rimbp3 APN 16 17211615 missense probably benign 0.00
IGL02649:Rimbp3 APN 16 17209608 nonsense probably null
IGL03285:Rimbp3 APN 16 17213232 missense probably benign 0.16
PIT4581001:Rimbp3 UTSW 16 17210716 missense possibly damaging 0.76
R0279:Rimbp3 UTSW 16 17209453 missense probably benign 0.00
R0605:Rimbp3 UTSW 16 17211699 missense probably damaging 0.99
R0674:Rimbp3 UTSW 16 17212737 missense probably benign 0.02
R1676:Rimbp3 UTSW 16 17211113 missense probably benign 0.13
R1780:Rimbp3 UTSW 16 17212632 missense probably benign
R1946:Rimbp3 UTSW 16 17210427 missense probably benign 0.10
R2113:Rimbp3 UTSW 16 17209675 missense probably benign 0.00
R3847:Rimbp3 UTSW 16 17210299 missense probably benign 0.13
R3849:Rimbp3 UTSW 16 17210299 missense probably benign 0.13
R3850:Rimbp3 UTSW 16 17210299 missense probably benign 0.13
R4355:Rimbp3 UTSW 16 17209692 missense possibly damaging 0.56
R4646:Rimbp3 UTSW 16 17213098 missense probably damaging 0.99
R4669:Rimbp3 UTSW 16 17209189 missense possibly damaging 0.88
R4732:Rimbp3 UTSW 16 17210601 missense possibly damaging 0.94
R4733:Rimbp3 UTSW 16 17210601 missense possibly damaging 0.94
R5025:Rimbp3 UTSW 16 17209807 missense probably damaging 0.99
R5039:Rimbp3 UTSW 16 17213331 missense probably damaging 0.99
R5177:Rimbp3 UTSW 16 17209917 missense possibly damaging 0.85
R5311:Rimbp3 UTSW 16 17210844 missense probably benign 0.00
R5942:Rimbp3 UTSW 16 17211888 missense probably benign 0.00
R6063:Rimbp3 UTSW 16 17210917 missense probably damaging 1.00
R6092:Rimbp3 UTSW 16 17212270 missense probably damaging 1.00
R6126:Rimbp3 UTSW 16 17212276 missense probably benign 0.25
R6288:Rimbp3 UTSW 16 17212908 missense probably benign 0.22
R6446:Rimbp3 UTSW 16 17212929 missense probably benign 0.00
R6773:Rimbp3 UTSW 16 17209015 missense probably damaging 1.00
R7017:Rimbp3 UTSW 16 17209746 missense probably benign 0.04
R7043:Rimbp3 UTSW 16 17211108 missense probably damaging 1.00
R7048:Rimbp3 UTSW 16 17210326 missense probably benign 0.20
R7378:Rimbp3 UTSW 16 17211204 missense probably benign
R7440:Rimbp3 UTSW 16 17213201 missense possibly damaging 0.78
R7788:Rimbp3 UTSW 16 17212704 missense probably benign 0.00
R7879:Rimbp3 UTSW 16 17211046 missense possibly damaging 0.71
R8071:Rimbp3 UTSW 16 17210863 missense probably benign
R8272:Rimbp3 UTSW 16 17209105 missense possibly damaging 0.85
R8419:Rimbp3 UTSW 16 17213022 missense probably damaging 0.97
R8819:Rimbp3 UTSW 16 17210907 missense probably benign 0.17
R8830:Rimbp3 UTSW 16 17209006 missense probably damaging 0.98
R8936:Rimbp3 UTSW 16 17213020 missense probably benign
R8982:Rimbp3 UTSW 16 17209647 missense probably benign 0.11
R9365:Rimbp3 UTSW 16 17208756 missense possibly damaging 0.93
Z1176:Rimbp3 UTSW 16 17209474 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- CTGACATTGGTCCCACTGCACTAC -3'
(R):5'- AGTCTATGGTCACAGGGAGCCAAC -3'

Sequencing Primer
(F):5'- CTGGGCACAGCAAAGTCTTG -3'
(R):5'- AGAGGCATGGTGTTCCAC -3'
Posted On 2013-05-23