Incidental Mutation 'R0465:BC027072'
ID41606
Institutional Source Beutler Lab
Gene Symbol BC027072
Ensembl Gene ENSMUSG00000044375
Gene NamecDNA sequence BC027072
Synonyms
MMRRC Submission 038665-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.121) question?
Stock #R0465 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location71743557-71752885 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 71750160 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 841 (C841R)
Ref Sequence ENSEMBL: ENSMUSP00000051871 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057405]
Predicted Effect probably benign
Transcript: ENSMUST00000057405
AA Change: C841R

PolyPhen 2 Score 0.422 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000051871
Gene: ENSMUSG00000044375
AA Change: C841R

DomainStartEndE-ValueType
Pfam:Retinal 1 1255 N/A PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.2%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is highly expressed in photoreceptors and may associate with the primary cilium of the outer segment. The encoded protein appears to undergo post-translational lipid modification. Nonsense and missense variants of this gene appear to cause a recessive form of retinitis pigmentosa. [provided by RefSeq, Jun 2010]
PHENOTYPE: Mice homozygous for a knock-out allele develop severe early-onset retinal degeneration associated with a disorganized outer segment, progressive thinning of the outer nuclear layer, microglia activation, decreased a- and b-wave amplitudes, and nearly undetectable ERG responses by 8 weeks of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
8030411F24Rik A G 2: 148,783,425 N93S probably benign Het
Adgre4 T A 17: 55,785,137 probably benign Het
Ankrd13a T A 5: 114,804,234 I526N probably damaging Het
Aox1 G A 1: 58,062,207 V446I probably damaging Het
Arid1b G A 17: 4,996,260 G441D possibly damaging Het
Bdkrb2 A T 12: 105,591,859 N120Y possibly damaging Het
Bud31 G A 5: 145,146,586 V80I probably damaging Het
Camkmt T A 17: 85,431,522 F225L probably damaging Het
Carf T C 1: 60,131,983 M200T probably damaging Het
Carmil3 T C 14: 55,499,861 L767P probably damaging Het
Cdk14 T A 5: 5,093,019 R237S probably damaging Het
Cdx2 C A 5: 147,306,473 K170N possibly damaging Het
Cfap65 G A 1: 74,916,884 R1093C possibly damaging Het
Cnot8 T A 11: 58,114,060 V195E probably damaging Het
Copa T C 1: 172,118,305 F936S probably damaging Het
Dnaic1 T A 4: 41,629,988 probably null Het
Dsel T C 1: 111,862,262 N181S probably benign Het
Enpp7 A G 11: 118,988,781 N87S probably damaging Het
Fads1 C T 19: 10,183,065 P5L probably benign Het
G3bp1 T C 11: 55,498,626 F383L probably damaging Het
Gm12695 T C 4: 96,785,075 Y29C probably damaging Het
Gm5592 T A 7: 41,156,057 probably benign Het
Gmnc T G 16: 26,962,952 N109T probably damaging Het
Gstcd A G 3: 132,983,144 I615T probably benign Het
Hal A C 10: 93,516,284 K646Q probably benign Het
Hbs1l A G 10: 21,352,041 I472V probably null Het
Ift27 A T 15: 78,173,758 probably benign Het
Iqub A T 6: 24,503,784 I163N probably damaging Het
Isg20l2 T A 3: 87,931,680 V66E probably benign Het
Itgb4 T C 11: 115,979,756 M137T probably damaging Het
Lca5 T A 9: 83,395,867 K475* probably null Het
Lyve1 A G 7: 110,852,827 probably null Het
Map3k19 T C 1: 127,838,527 D220G probably damaging Het
Mdn1 T A 4: 32,699,204 probably benign Het
Mmp15 T C 8: 95,367,998 W167R probably damaging Het
Ms4a13 A G 19: 11,172,593 C135R probably benign Het
Myh1 A G 11: 67,210,417 H673R possibly damaging Het
Myrf G C 19: 10,218,162 T428S probably benign Het
Oas2 A G 5: 120,735,055 I645T probably damaging Het
Olfr605 A T 7: 103,442,835 F96Y possibly damaging Het
Pard3b T G 1: 62,211,718 probably benign Het
Patj T A 4: 98,535,507 probably null Het
Pkd1l3 G A 8: 109,623,663 S380N probably benign Het
Pkd1l3 C G 8: 109,623,649 D375E possibly damaging Het
Rab34 C A 11: 78,190,511 C67* probably null Het
Rimbp3 T C 16: 17,211,780 S1023P possibly damaging Het
Rnf148 T C 6: 23,654,685 N104S probably benign Het
Rpa1 T C 11: 75,313,095 T288A probably damaging Het
Scn9a A G 2: 66,526,996 L976P probably damaging Het
Serpina12 T A 12: 104,037,845 D176V probably benign Het
Sik1 C T 17: 31,855,022 V10I possibly damaging Het
Sntb1 C A 15: 55,749,276 R302L probably benign Het
Stambp A G 6: 83,570,339 I56T probably benign Het
Tac2 A G 10: 127,729,170 probably benign Het
Tecta A T 9: 42,359,418 I1198K possibly damaging Het
Tfip11 C T 5: 112,333,264 R369C probably benign Het
Tnpo1 A G 13: 98,884,634 I79T probably damaging Het
Ttll5 A T 12: 85,933,326 N895Y probably benign Het
Ube2u T A 4: 100,532,096 probably benign Het
Ubxn4 G A 1: 128,262,904 E256K probably benign Het
Vmn2r1 T C 3: 64,081,759 S40P possibly damaging Het
Vmn2r100 G A 17: 19,531,530 V612I probably damaging Het
Vmn2r59 G T 7: 42,046,908 H137N probably benign Het
Vsig10l T C 7: 43,467,442 V467A probably damaging Het
Vwde A G 6: 13,215,806 probably benign Het
Xrra1 T A 7: 99,879,371 D139E probably benign Het
Zc3h15 T C 2: 83,663,815 probably benign Het
Zfhx4 C T 3: 5,245,656 probably benign Het
Zscan18 A G 7: 12,775,486 probably benign Het
Other mutations in BC027072
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02010:BC027072 APN 17 71749464 missense probably benign 0.38
IGL02033:BC027072 APN 17 71751081 missense probably damaging 1.00
IGL02711:BC027072 APN 17 71749382 missense probably benign 0.15
IGL03185:BC027072 APN 17 71749337 missense probably damaging 0.98
IGL03242:BC027072 APN 17 71750271 missense probably benign 0.01
R0367:BC027072 UTSW 17 71750476 missense probably damaging 1.00
R0413:BC027072 UTSW 17 71752217 missense probably benign 0.38
R0535:BC027072 UTSW 17 71752439 missense probably benign 0.01
R0681:BC027072 UTSW 17 71749514 missense probably benign 0.00
R0736:BC027072 UTSW 17 71744664 missense probably benign 0.00
R1406:BC027072 UTSW 17 71749161 missense probably benign 0.18
R1406:BC027072 UTSW 17 71749161 missense probably benign 0.18
R1530:BC027072 UTSW 17 71749478 missense probably benign 0.01
R1723:BC027072 UTSW 17 71750378 missense probably damaging 1.00
R1941:BC027072 UTSW 17 71752068 missense probably damaging 1.00
R2179:BC027072 UTSW 17 71752526 missense probably damaging 1.00
R2232:BC027072 UTSW 17 71749284 missense probably benign 0.00
R2519:BC027072 UTSW 17 71751647 missense probably damaging 1.00
R2997:BC027072 UTSW 17 71744711 critical splice acceptor site probably benign
R3899:BC027072 UTSW 17 71750160 missense probably benign 0.00
R4890:BC027072 UTSW 17 71752311 missense possibly damaging 0.50
R4898:BC027072 UTSW 17 71751071 missense probably damaging 1.00
R5347:BC027072 UTSW 17 71749935 missense probably benign 0.00
R5436:BC027072 UTSW 17 71750842 missense probably damaging 1.00
R5527:BC027072 UTSW 17 71752640 missense probably damaging 1.00
R5556:BC027072 UTSW 17 71752425 missense possibly damaging 0.81
R5625:BC027072 UTSW 17 71751326 missense probably damaging 1.00
R5707:BC027072 UTSW 17 71751572 missense possibly damaging 0.90
R5932:BC027072 UTSW 17 71751753 missense probably damaging 1.00
R6043:BC027072 UTSW 17 71750042 missense probably damaging 1.00
R6314:BC027072 UTSW 17 71752457 missense probably benign 0.04
R6513:BC027072 UTSW 17 71744706 missense probably damaging 1.00
R7575:BC027072 UTSW 17 71750855 missense probably damaging 1.00
R7638:BC027072 UTSW 17 71750885 missense probably damaging 1.00
R7848:BC027072 UTSW 17 71749193 missense probably benign 0.04
R8317:BC027072 UTSW 17 71749202 missense probably benign 0.10
R8530:BC027072 UTSW 17 71752106 missense probably damaging 1.00
R8671:BC027072 UTSW 17 71751377 missense probably benign 0.34
R8831:BC027072 UTSW 17 71752310 missense probably benign 0.01
R8854:BC027072 UTSW 17 71749331 missense probably benign
R8941:BC027072 UTSW 17 71752142 missense probably benign 0.06
X0035:BC027072 UTSW 17 71744711 critical splice acceptor site probably benign
Z1177:BC027072 UTSW 17 71750403 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAAGAGTGTGGGTCTCGTGAAAAC -3'
(R):5'- TAAGCCCCAGATTTCTCCAGCAGC -3'

Sequencing Primer
(F):5'- AGGTCCAAGGTCAACTTTCTG -3'
(R):5'- CAGCAGCAGGCTGGAGG -3'
Posted On2013-05-23