Incidental Mutation 'R0465:Camkmt'
ID41607
Institutional Source Beutler Lab
Gene Symbol Camkmt
Ensembl Gene ENSMUSG00000071037
Gene Namecalmodulin-lysine N-methyltransferase
Synonyms1700106N22Rik
MMRRC Submission 038665-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0465 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location85090726-85458139 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 85431522 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 225 (F225L)
Ref Sequence ENSEMBL: ENSMUSP00000092811 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095188]
Predicted Effect probably damaging
Transcript: ENSMUST00000095188
AA Change: F225L

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000092811
Gene: ENSMUSG00000071037
AA Change: F225L

DomainStartEndE-ValueType
low complexity region 6 18 N/A INTRINSIC
low complexity region 39 53 N/A INTRINSIC
Pfam:Methyltransf_16 110 278 7.7e-22 PFAM
Meta Mutation Damage Score 0.254 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.2%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a class I protein methyltransferase that acts in the formation of trimethyllysine in calmodulin. The protein contains a AdoMet-binding motif and may play a role in calcium-dependent signaling. [provided by RefSeq, Sep 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced body weight, reduced muscle strength and altered somatosensory development and brain function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
8030411F24Rik A G 2: 148,783,425 N93S probably benign Het
Adgre4 T A 17: 55,785,137 probably benign Het
Ankrd13a T A 5: 114,804,234 I526N probably damaging Het
Aox1 G A 1: 58,062,207 V446I probably damaging Het
Arid1b G A 17: 4,996,260 G441D possibly damaging Het
BC027072 A G 17: 71,750,160 C841R probably benign Het
Bdkrb2 A T 12: 105,591,859 N120Y possibly damaging Het
Bud31 G A 5: 145,146,586 V80I probably damaging Het
Carf T C 1: 60,131,983 M200T probably damaging Het
Carmil3 T C 14: 55,499,861 L767P probably damaging Het
Cdk14 T A 5: 5,093,019 R237S probably damaging Het
Cdx2 C A 5: 147,306,473 K170N possibly damaging Het
Cfap65 G A 1: 74,916,884 R1093C possibly damaging Het
Cnot8 T A 11: 58,114,060 V195E probably damaging Het
Copa T C 1: 172,118,305 F936S probably damaging Het
Dnaic1 T A 4: 41,629,988 probably null Het
Dsel T C 1: 111,862,262 N181S probably benign Het
Enpp7 A G 11: 118,988,781 N87S probably damaging Het
Fads1 C T 19: 10,183,065 P5L probably benign Het
G3bp1 T C 11: 55,498,626 F383L probably damaging Het
Gm12695 T C 4: 96,785,075 Y29C probably damaging Het
Gm5592 T A 7: 41,156,057 probably benign Het
Gmnc T G 16: 26,962,952 N109T probably damaging Het
Gstcd A G 3: 132,983,144 I615T probably benign Het
Hal A C 10: 93,516,284 K646Q probably benign Het
Hbs1l A G 10: 21,352,041 I472V probably null Het
Ift27 A T 15: 78,173,758 probably benign Het
Iqub A T 6: 24,503,784 I163N probably damaging Het
Isg20l2 T A 3: 87,931,680 V66E probably benign Het
Itgb4 T C 11: 115,979,756 M137T probably damaging Het
Lca5 T A 9: 83,395,867 K475* probably null Het
Lyve1 A G 7: 110,852,827 probably null Het
Map3k19 T C 1: 127,838,527 D220G probably damaging Het
Mdn1 T A 4: 32,699,204 probably benign Het
Mmp15 T C 8: 95,367,998 W167R probably damaging Het
Ms4a13 A G 19: 11,172,593 C135R probably benign Het
Myh1 A G 11: 67,210,417 H673R possibly damaging Het
Myrf G C 19: 10,218,162 T428S probably benign Het
Oas2 A G 5: 120,735,055 I645T probably damaging Het
Olfr605 A T 7: 103,442,835 F96Y possibly damaging Het
Pard3b T G 1: 62,211,718 probably benign Het
Patj T A 4: 98,535,507 probably null Het
Pkd1l3 G A 8: 109,623,663 S380N probably benign Het
Pkd1l3 C G 8: 109,623,649 D375E possibly damaging Het
Rab34 C A 11: 78,190,511 C67* probably null Het
Rimbp3 T C 16: 17,211,780 S1023P possibly damaging Het
Rnf148 T C 6: 23,654,685 N104S probably benign Het
Rpa1 T C 11: 75,313,095 T288A probably damaging Het
Scn9a A G 2: 66,526,996 L976P probably damaging Het
Serpina12 T A 12: 104,037,845 D176V probably benign Het
Sik1 C T 17: 31,855,022 V10I possibly damaging Het
Sntb1 C A 15: 55,749,276 R302L probably benign Het
Stambp A G 6: 83,570,339 I56T probably benign Het
Tac2 A G 10: 127,729,170 probably benign Het
Tecta A T 9: 42,359,418 I1198K possibly damaging Het
Tfip11 C T 5: 112,333,264 R369C probably benign Het
Tnpo1 A G 13: 98,884,634 I79T probably damaging Het
Ttll5 A T 12: 85,933,326 N895Y probably benign Het
Ube2u T A 4: 100,532,096 probably benign Het
Ubxn4 G A 1: 128,262,904 E256K probably benign Het
Vmn2r1 T C 3: 64,081,759 S40P possibly damaging Het
Vmn2r100 G A 17: 19,531,530 V612I probably damaging Het
Vmn2r59 G T 7: 42,046,908 H137N probably benign Het
Vsig10l T C 7: 43,467,442 V467A probably damaging Het
Vwde A G 6: 13,215,806 probably benign Het
Xrra1 T A 7: 99,879,371 D139E probably benign Het
Zc3h15 T C 2: 83,663,815 probably benign Het
Zfhx4 C T 3: 5,245,656 probably benign Het
Zscan18 A G 7: 12,775,486 probably benign Het
Other mutations in Camkmt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00433:Camkmt APN 17 85096666 splice site probably benign
IGL00786:Camkmt APN 17 85096491 missense probably damaging 0.99
IGL00840:Camkmt APN 17 85458123 nonsense probably null
IGL02604:Camkmt APN 17 85096625 missense possibly damaging 0.74
IGL02809:Camkmt APN 17 85394648 missense probably damaging 1.00
R0537:Camkmt UTSW 17 85394659 missense probably benign 0.01
R1573:Camkmt UTSW 17 85096530 missense probably damaging 0.98
R2442:Camkmt UTSW 17 85090775 missense possibly damaging 0.51
R2878:Camkmt UTSW 17 85431551 splice site probably benign
R5121:Camkmt UTSW 17 85096581 missense probably benign 0.00
R5174:Camkmt UTSW 17 85452237 missense probably benign
R6006:Camkmt UTSW 17 85452238 missense possibly damaging 0.71
R6587:Camkmt UTSW 17 85113815 missense possibly damaging 0.74
R6726:Camkmt UTSW 17 85394609 missense probably damaging 0.98
R7301:Camkmt UTSW 17 85431493 missense probably benign 0.10
R7523:Camkmt UTSW 17 85391628 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CCCTTCAAGCCACATCGATCATTGC -3'
(R):5'- AGACTACCTCCTAGCTGTCACATGG -3'

Sequencing Primer
(F):5'- GGGGCAGGAATCATTCTATCC -3'
(R):5'- CTCCTAGCTGTCACATGGAGATG -3'
Posted On2013-05-23