Incidental Mutation 'R0466:Gcg'
ID41619
Institutional Source Beutler Lab
Gene Symbol Gcg
Ensembl Gene ENSMUSG00000000394
Gene Nameglucagon
SynonymsPPG, glucagon-like peptide I, GLP-1, Glu
MMRRC Submission 038666-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.221) question?
Stock #R0466 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location62474530-62483650 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 62476938 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 93 (D93G)
Ref Sequence ENSEMBL: ENSMUSP00000099794 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102733] [ENSMUST00000136686]
Predicted Effect probably damaging
Transcript: ENSMUST00000102733
AA Change: D93G

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000099794
Gene: ENSMUSG00000000394
AA Change: D93G

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
GLUCA 53 79 7.5e-15 SMART
GLUCA 98 124 4.06e-11 SMART
GLUCA 146 172 1.97e-9 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000136686
AA Change: D93G

PolyPhen 2 Score 0.514 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000115892
Gene: ENSMUSG00000000394
AA Change: D93G

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
GLUCA 53 79 7.5e-15 SMART
GLUCA 98 124 4.06e-11 SMART
GLUCA 146 172 1.97e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155624
Meta Mutation Damage Score 0.046 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency 97% (63/65)
MGI Phenotype FUNCTION: This gene encodes glucagon, a pancreatic hormone that counteracts the action of insulin in the bloodstream. The encoded protein is processed to generate glucagon and two other glucagon-like peptides, GLP1 and GLP2. Glucagon stimulates gluconeogenesis, glycogenolysis and lipolysis. GLP1 induces secretion of insulin, suppresses glucagon secretion and inhibits feeding. GLP2 induces intestinal absorption of glucose by stimulating the growth of intestinal cells and preventing apoptosis. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit islet alpha cell hyperplasia and increased body weight. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210407C18Rik T C 11: 58,612,505 probably benign Het
4933412E24Rik T C 15: 60,015,472 Y373C probably benign Het
Abca12 T G 1: 71,302,663 Q1046H probably damaging Het
Adgrv1 A G 13: 81,566,296 F956S probably benign Het
Alk A G 17: 71,905,157 V797A possibly damaging Het
Armc4 T A 18: 7,286,758 I158F probably benign Het
Ascl2 A G 7: 142,968,480 L77P probably benign Het
Aspm A T 1: 139,477,901 I1509F probably damaging Het
AY358078 A T 14: 51,805,632 Y259F unknown Het
Cbs G A 17: 31,616,152 A450V probably benign Het
Cdh11 T A 8: 102,670,058 Q213L possibly damaging Het
Cdh26 C T 2: 178,481,632 R675C possibly damaging Het
Cfap126 T C 1: 171,126,200 I113T probably damaging Het
Clk4 A G 11: 51,267,328 D53G possibly damaging Het
Dab1 T C 4: 104,720,550 L272P probably benign Het
Dmtf1 A T 5: 9,132,454 probably null Het
Dph5 A C 3: 115,928,710 D279A probably benign Het
Fbxw19 T A 9: 109,478,649 T461S probably benign Het
G3bp1 T C 11: 55,498,626 F383L probably damaging Het
Gmps A G 3: 63,993,944 T395A probably damaging Het
H2-Ob A G 17: 34,242,659 D124G probably damaging Het
Itga8 G T 2: 12,232,886 A341E probably damaging Het
Itih3 A G 14: 30,912,874 probably null Het
Kcnh4 C T 11: 100,746,932 G633E probably benign Het
Kif2c C T 4: 117,172,292 R215Q possibly damaging Het
Letm1 A C 5: 33,761,730 probably benign Het
Mmp3 A G 9: 7,450,165 D299G probably damaging Het
Myh8 G T 11: 67,298,579 A1194S probably benign Het
Naip2 A C 13: 100,161,782 I582S probably benign Het
Nfib A C 4: 82,498,538 Y87D probably damaging Het
Nlrp4a T C 7: 26,462,620 probably benign Het
Nsmce1 A T 7: 125,472,236 probably benign Het
Olfr834 T G 9: 18,988,255 V89G probably benign Het
Olfr845 A T 9: 19,339,179 T240S probably damaging Het
Patj C A 4: 98,688,156 Q1193K probably damaging Het
Pcdhb5 G A 18: 37,322,543 V659M probably damaging Het
Pkd1l3 C G 8: 109,623,649 D375E possibly damaging Het
Pmis2 T C 7: 30,671,392 I46V probably benign Het
Ppp2r5e A G 12: 75,462,442 probably benign Het
Prom2 A G 2: 127,528,789 F825S probably damaging Het
Rab11fip2 G A 19: 59,906,243 A524V possibly damaging Het
Rb1cc1 A C 1: 6,263,267 probably null Het
Rwdd3 G C 3: 121,159,019 Q180E possibly damaging Het
Sema6a G A 18: 47,290,045 probably null Het
Sgcg A T 14: 61,221,686 C265S probably damaging Het
Slc16a3 T C 11: 120,958,052 S445P possibly damaging Het
Slc22a3 G A 17: 12,458,493 Q263* probably null Het
Sorcs3 A G 19: 48,748,319 T694A probably benign Het
Tbc1d15 T C 10: 115,219,172 K322E probably damaging Het
Tecta G T 9: 42,373,073 F905L probably benign Het
Tmeff1 A G 4: 48,636,853 I184V possibly damaging Het
Ttf1 A G 2: 29,065,407 H261R possibly damaging Het
Ttll6 T A 11: 96,145,591 L349M probably damaging Het
Ubac2 G A 14: 121,973,619 V134M probably damaging Het
Ubxn4 G A 1: 128,262,904 E256K probably benign Het
Vmn2r25 T G 6: 123,852,049 I89L probably benign Het
Vmn2r6 A C 3: 64,556,302 F370L probably damaging Het
Vps13b T A 15: 35,445,602 Y412* probably null Het
Zfp142 A G 1: 74,585,411 S85P possibly damaging Het
Zfp516 G A 18: 82,957,454 probably null Het
Other mutations in Gcg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01483:Gcg APN 2 62480483 missense possibly damaging 0.86
IGL02582:Gcg APN 2 62478578 nonsense probably null
R3620:Gcg UTSW 2 62476935 missense probably damaging 0.96
R3621:Gcg UTSW 2 62476935 missense probably damaging 0.96
R4744:Gcg UTSW 2 62478631 missense probably damaging 1.00
R4859:Gcg UTSW 2 62476845 missense probably damaging 0.96
R5807:Gcg UTSW 2 62475725 missense possibly damaging 0.54
R5971:Gcg UTSW 2 62475804 missense probably damaging 1.00
R6138:Gcg UTSW 2 62475804 missense probably damaging 1.00
R7191:Gcg UTSW 2 62476839 missense probably damaging 1.00
R7522:Gcg UTSW 2 62475759 missense probably benign 0.32
U15987:Gcg UTSW 2 62475804 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCAAGCAACTAAGAAACTTGCTCTC -3'
(R):5'- GCCCCTGGAAAAGGAAGGTTTAGTG -3'

Sequencing Primer
(F):5'- GTACAGTTTTTCCCATCGGATAG -3'
(R):5'- TTTCCCCACAAAGTTTCAATCCAG -3'
Posted On2013-05-23