Incidental Mutation 'R0466:Patj'
ID41628
Institutional Source Beutler Lab
Gene Symbol Patj
Ensembl Gene ENSMUSG00000061859
Gene NamePATJ, crumbs cell polarity complex component
SynonymsInadl, Cipp
MMRRC Submission 038666-MU
Accession Numbers

Genbank: NM_172696; MGI: 1277960

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0466 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location98395785-98719603 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 98688156 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 1193 (Q1193K)
Ref Sequence ENSEMBL: ENSMUSP00000102644 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030290] [ENSMUST00000041284] [ENSMUST00000102792] [ENSMUST00000107029]
Predicted Effect probably benign
Transcript: ENSMUST00000030290
AA Change: Q544K

PolyPhen 2 Score 0.273 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000030290
Gene: ENSMUSG00000061859
AA Change: Q544K

DomainStartEndE-ValueType
PDZ 31 106 6.12e-19 SMART
low complexity region 134 144 N/A INTRINSIC
low complexity region 188 206 N/A INTRINSIC
PDZ 258 333 4.36e-24 SMART
PDZ 355 428 2.49e-19 SMART
PDZ 496 573 1.73e-18 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000041284
AA Change: Q1766K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000049176
Gene: ENSMUSG00000061859
AA Change: Q1766K

DomainStartEndE-ValueType
L27 8 68 6.53e-9 SMART
PDZ 143 221 1.78e-20 SMART
PDZ 256 328 1.15e-23 SMART
PDZ 374 453 3.15e-21 SMART
coiled coil region 486 513 N/A INTRINSIC
PDZ 570 641 1.28e-12 SMART
PDZ 696 775 9.5e-16 SMART
low complexity region 980 991 N/A INTRINSIC
low complexity region 1054 1062 N/A INTRINSIC
PDZ 1083 1166 8.65e-19 SMART
PDZ 1253 1328 6.12e-19 SMART
low complexity region 1356 1366 N/A INTRINSIC
low complexity region 1410 1428 N/A INTRINSIC
PDZ 1480 1555 4.36e-24 SMART
PDZ 1577 1650 2.49e-19 SMART
PDZ 1718 1795 2.13e-18 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000102792
AA Change: Q544K

PolyPhen 2 Score 0.806 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000099854
Gene: ENSMUSG00000061859
AA Change: Q544K

DomainStartEndE-ValueType
PDZ 31 106 6.12e-19 SMART
low complexity region 134 144 N/A INTRINSIC
low complexity region 188 206 N/A INTRINSIC
PDZ 258 333 4.36e-24 SMART
PDZ 355 428 2.49e-19 SMART
PDZ 496 573 2.13e-18 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107029
AA Change: Q1193K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000102644
Gene: ENSMUSG00000061859
AA Change: Q1193K

DomainStartEndE-ValueType
PDZ 1 68 1e-9 SMART
PDZ 123 202 4.7e-18 SMART
low complexity region 407 418 N/A INTRINSIC
low complexity region 481 489 N/A INTRINSIC
PDZ 510 593 4.3e-21 SMART
PDZ 680 755 2.9e-21 SMART
low complexity region 783 793 N/A INTRINSIC
low complexity region 837 855 N/A INTRINSIC
PDZ 907 982 2.2e-26 SMART
PDZ 1004 1077 1.2e-21 SMART
PDZ 1145 1222 1e-20 SMART
Meta Mutation Damage Score 0.166 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency 97% (63/65)
MGI Phenotype FUNCTION: This gene encodes a multivalent PDZ domain protein, which is expressed exclusively in brain and kidney. This protein selectively interacts with inward rectifier K+ (Kir) family members, N-methyl-D-aspartate receptor subunits, neurexins and neuroligins, as well as cell surface molecules enriched in synaptic membranes. Thus, this protein may serve as a scaffold that brings structurally diverse but functionally connected proteins into close proximity at the synapse. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(5) : Gene trapped(5)

Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210407C18Rik T C 11: 58,612,505 probably benign Het
4933412E24Rik T C 15: 60,015,472 Y373C probably benign Het
Abca12 T G 1: 71,302,663 Q1046H probably damaging Het
Adgrv1 A G 13: 81,566,296 F956S probably benign Het
Alk A G 17: 71,905,157 V797A possibly damaging Het
Armc4 T A 18: 7,286,758 I158F probably benign Het
Ascl2 A G 7: 142,968,480 L77P probably benign Het
Aspm A T 1: 139,477,901 I1509F probably damaging Het
AY358078 A T 14: 51,805,632 Y259F unknown Het
Cbs G A 17: 31,616,152 A450V probably benign Het
Cdh11 T A 8: 102,670,058 Q213L possibly damaging Het
Cdh26 C T 2: 178,481,632 R675C possibly damaging Het
Cfap126 T C 1: 171,126,200 I113T probably damaging Het
Clk4 A G 11: 51,267,328 D53G possibly damaging Het
Dab1 T C 4: 104,720,550 L272P probably benign Het
Dmtf1 A T 5: 9,132,454 probably null Het
Dph5 A C 3: 115,928,710 D279A probably benign Het
Fbxw19 T A 9: 109,478,649 T461S probably benign Het
G3bp1 T C 11: 55,498,626 F383L probably damaging Het
Gcg T C 2: 62,476,938 D93G probably damaging Het
Gmps A G 3: 63,993,944 T395A probably damaging Het
H2-Ob A G 17: 34,242,659 D124G probably damaging Het
Itga8 G T 2: 12,232,886 A341E probably damaging Het
Itih3 A G 14: 30,912,874 probably null Het
Kcnh4 C T 11: 100,746,932 G633E probably benign Het
Kif2c C T 4: 117,172,292 R215Q possibly damaging Het
Letm1 A C 5: 33,761,730 probably benign Het
Mmp3 A G 9: 7,450,165 D299G probably damaging Het
Myh8 G T 11: 67,298,579 A1194S probably benign Het
Naip2 A C 13: 100,161,782 I582S probably benign Het
Nfib A C 4: 82,498,538 Y87D probably damaging Het
Nlrp4a T C 7: 26,462,620 probably benign Het
Nsmce1 A T 7: 125,472,236 probably benign Het
Olfr834 T G 9: 18,988,255 V89G probably benign Het
Olfr845 A T 9: 19,339,179 T240S probably damaging Het
Pcdhb5 G A 18: 37,322,543 V659M probably damaging Het
Pkd1l3 C G 8: 109,623,649 D375E possibly damaging Het
Pmis2 T C 7: 30,671,392 I46V probably benign Het
Ppp2r5e A G 12: 75,462,442 probably benign Het
Prom2 A G 2: 127,528,789 F825S probably damaging Het
Rab11fip2 G A 19: 59,906,243 A524V possibly damaging Het
Rb1cc1 A C 1: 6,263,267 probably null Het
Rwdd3 G C 3: 121,159,019 Q180E possibly damaging Het
Sema6a G A 18: 47,290,045 probably null Het
Sgcg A T 14: 61,221,686 C265S probably damaging Het
Slc16a3 T C 11: 120,958,052 S445P possibly damaging Het
Slc22a3 G A 17: 12,458,493 Q263* probably null Het
Sorcs3 A G 19: 48,748,319 T694A probably benign Het
Tbc1d15 T C 10: 115,219,172 K322E probably damaging Het
Tecta G T 9: 42,373,073 F905L probably benign Het
Tmeff1 A G 4: 48,636,853 I184V possibly damaging Het
Ttf1 A G 2: 29,065,407 H261R possibly damaging Het
Ttll6 T A 11: 96,145,591 L349M probably damaging Het
Ubac2 G A 14: 121,973,619 V134M probably damaging Het
Ubxn4 G A 1: 128,262,904 E256K probably benign Het
Vmn2r25 T G 6: 123,852,049 I89L probably benign Het
Vmn2r6 A C 3: 64,556,302 F370L probably damaging Het
Vps13b T A 15: 35,445,602 Y412* probably null Het
Zfp142 A G 1: 74,585,411 S85P possibly damaging Het
Zfp516 G A 18: 82,957,454 probably null Het
Other mutations in Patj
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Patj APN 4 98465106 missense probably damaging 1.00
IGL00095:Patj APN 4 98535562 missense possibly damaging 0.78
IGL00517:Patj APN 4 98441071 missense possibly damaging 0.95
IGL00802:Patj APN 4 98424406 missense possibly damaging 0.93
IGL01064:Patj APN 4 98496973 missense possibly damaging 0.95
IGL01110:Patj APN 4 98413024 missense probably damaging 0.99
IGL01407:Patj APN 4 98413050 missense possibly damaging 0.49
IGL01821:Patj APN 4 98456211 missense probably damaging 1.00
IGL02399:Patj APN 4 98591936 missense probably damaging 1.00
IGL02494:Patj APN 4 98703987 splice site probably benign
IGL02803:Patj APN 4 98426064 missense probably damaging 0.99
IGL02931:Patj APN 4 98411173 splice site probably benign
IGL03017:Patj APN 4 98465027 splice site probably benign
IGL03115:Patj APN 4 98443803 missense probably damaging 1.00
IGL03209:Patj APN 4 98465140 missense probably null 1.00
IGL03377:Patj APN 4 98465104 missense probably damaging 1.00
D4186:Patj UTSW 4 98638762 missense probably benign 0.17
PIT4531001:Patj UTSW 4 98441090 missense probably damaging 0.98
R0136:Patj UTSW 4 98667648 missense probably damaging 1.00
R0294:Patj UTSW 4 98497048 missense probably damaging 0.99
R0376:Patj UTSW 4 98568987 missense probably damaging 1.00
R0463:Patj UTSW 4 98674308 missense probably damaging 1.00
R0465:Patj UTSW 4 98535507 splice site probably null
R0544:Patj UTSW 4 98569110 missense probably damaging 1.00
R0624:Patj UTSW 4 98681235 splice site probably benign
R0657:Patj UTSW 4 98667648 missense probably damaging 1.00
R1281:Patj UTSW 4 98416695 missense probably damaging 1.00
R1393:Patj UTSW 4 98424411 missense probably benign 0.01
R1480:Patj UTSW 4 98469582 missense probably damaging 1.00
R1667:Patj UTSW 4 98413027 missense probably damaging 1.00
R1728:Patj UTSW 4 98431780 missense possibly damaging 0.50
R1729:Patj UTSW 4 98431780 missense possibly damaging 0.50
R1797:Patj UTSW 4 98687438 missense probably damaging 1.00
R1818:Patj UTSW 4 98623648 missense possibly damaging 0.85
R1835:Patj UTSW 4 98491590 missense probably benign 0.00
R1880:Patj UTSW 4 98497240 missense probably benign 0.00
R2009:Patj UTSW 4 98456169 missense probably damaging 1.00
R2090:Patj UTSW 4 98437323 unclassified probably benign
R2120:Patj UTSW 4 98456225 missense probably benign 0.01
R2180:Patj UTSW 4 98523502 critical splice donor site probably null
R2655:Patj UTSW 4 98437450 missense possibly damaging 0.64
R3156:Patj UTSW 4 98674228 missense probably damaging 1.00
R3749:Patj UTSW 4 98469600 missense probably damaging 1.00
R3767:Patj UTSW 4 98681219 nonsense probably null
R3913:Patj UTSW 4 98569101 missense probably damaging 0.99
R3917:Patj UTSW 4 98592008 nonsense probably null
R3918:Patj UTSW 4 98456218 missense probably damaging 1.00
R4299:Patj UTSW 4 98677321 missense possibly damaging 0.89
R4355:Patj UTSW 4 98650454 missense possibly damaging 0.87
R4471:Patj UTSW 4 98535579 missense probably damaging 1.00
R4762:Patj UTSW 4 98405570 nonsense probably null
R4877:Patj UTSW 4 98569058 missense possibly damaging 0.94
R4945:Patj UTSW 4 98495064 missense probably damaging 0.97
R5274:Patj UTSW 4 98518981 missense probably damaging 0.99
R5343:Patj UTSW 4 98676193 missense probably damaging 1.00
R5554:Patj UTSW 4 98454396 missense possibly damaging 0.79
R5688:Patj UTSW 4 98520810 nonsense probably null
R5880:Patj UTSW 4 98411145 missense probably damaging 0.96
R5972:Patj UTSW 4 98569053 missense probably damaging 0.98
R6149:Patj UTSW 4 98424325 missense possibly damaging 0.72
R6192:Patj UTSW 4 98456157 missense probably damaging 1.00
R6265:Patj UTSW 4 98469567 missense probably benign 0.08
R6350:Patj UTSW 4 98405618 missense probably benign 0.26
R6363:Patj UTSW 4 98431860 missense probably benign 0.25
R6434:Patj UTSW 4 98491629 missense probably damaging 1.00
R6496:Patj UTSW 4 98416752 missense probably damaging 1.00
R6896:Patj UTSW 4 98426050 missense possibly damaging 0.87
R7039:Patj UTSW 4 98569078 missense probably damaging 0.96
R7040:Patj UTSW 4 98441080 missense probably benign 0.02
R7052:Patj UTSW 4 98677260 missense probably benign 0.03
R7066:Patj UTSW 4 98413197 missense probably benign 0.24
R7236:Patj UTSW 4 98411057 missense probably damaging 1.00
R7242:Patj UTSW 4 98591933 missense probably benign 0.26
R7260:Patj UTSW 4 98416733 missense possibly damaging 0.94
R7412:Patj UTSW 4 98411139 missense probably damaging 0.98
R7493:Patj UTSW 4 98495061 missense probably benign 0.41
R7570:Patj UTSW 4 98424500 splice site probably null
R7571:Patj UTSW 4 98568980 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGATGGGACTGCATTTGGGAACAC -3'
(R):5'- CACGGGGCCATAGCTGATCAATAAC -3'

Sequencing Primer
(F):5'- CATTTGGGAACACCCATTAAAAATTC -3'
(R):5'- GAAGCTGAGAGTAATTTTTCTCCCC -3'
Posted On2013-05-23