Incidental Mutation 'R0466:Tbc1d15'
ID41645
Institutional Source Beutler Lab
Gene Symbol Tbc1d15
Ensembl Gene ENSMUSG00000020130
Gene NameTBC1 domain family, member 15
SynonymsLy6dl, 4432405K22Rik
MMRRC Submission 038666-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.278) question?
Stock #R0466 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location115197872-115251467 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 115219172 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 322 (K322E)
Ref Sequence ENSEMBL: ENSMUSP00000020339 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020339]
Predicted Effect probably damaging
Transcript: ENSMUST00000020339
AA Change: K322E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000020339
Gene: ENSMUSG00000020130
AA Change: K322E

DomainStartEndE-ValueType
Pfam:DUF3548 6 224 1.3e-87 PFAM
TBC 326 564 1.14e-50 SMART
Blast:TBC 602 671 5e-23 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217843
Meta Mutation Damage Score 0.3799 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency 97% (63/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Ras-like proteins in brain-GTPase activating protein superfamily that share a conserved Tre-2/Bub2/Cdc16 domain. The encoded protein interacts with Ras-like protein in brain 5A and may function as a regulator of intracellular trafficking. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Apr 2009]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210407C18Rik T C 11: 58,612,505 probably benign Het
4933412E24Rik T C 15: 60,015,472 Y373C probably benign Het
Abca12 T G 1: 71,302,663 Q1046H probably damaging Het
Adgrv1 A G 13: 81,566,296 F956S probably benign Het
Alk A G 17: 71,905,157 V797A possibly damaging Het
Armc4 T A 18: 7,286,758 I158F probably benign Het
Ascl2 A G 7: 142,968,480 L77P probably benign Het
Aspm A T 1: 139,477,901 I1509F probably damaging Het
AY358078 A T 14: 51,805,632 Y259F unknown Het
Cbs G A 17: 31,616,152 A450V probably benign Het
Cdh11 T A 8: 102,670,058 Q213L possibly damaging Het
Cdh26 C T 2: 178,481,632 R675C possibly damaging Het
Cfap126 T C 1: 171,126,200 I113T probably damaging Het
Clk4 A G 11: 51,267,328 D53G possibly damaging Het
Dab1 T C 4: 104,720,550 L272P probably benign Het
Dmtf1 A T 5: 9,132,454 probably null Het
Dph5 A C 3: 115,928,710 D279A probably benign Het
Fbxw19 T A 9: 109,478,649 T461S probably benign Het
G3bp1 T C 11: 55,498,626 F383L probably damaging Het
Gcg T C 2: 62,476,938 D93G probably damaging Het
Gmps A G 3: 63,993,944 T395A probably damaging Het
H2-Ob A G 17: 34,242,659 D124G probably damaging Het
Itga8 G T 2: 12,232,886 A341E probably damaging Het
Itih3 A G 14: 30,912,874 probably null Het
Kcnh4 C T 11: 100,746,932 G633E probably benign Het
Kif2c C T 4: 117,172,292 R215Q possibly damaging Het
Letm1 A C 5: 33,761,730 probably benign Het
Mmp3 A G 9: 7,450,165 D299G probably damaging Het
Myh8 G T 11: 67,298,579 A1194S probably benign Het
Naip2 A C 13: 100,161,782 I582S probably benign Het
Nfib A C 4: 82,498,538 Y87D probably damaging Het
Nlrp4a T C 7: 26,462,620 probably benign Het
Nsmce1 A T 7: 125,472,236 probably benign Het
Olfr834 T G 9: 18,988,255 V89G probably benign Het
Olfr845 A T 9: 19,339,179 T240S probably damaging Het
Patj C A 4: 98,688,156 Q1193K probably damaging Het
Pcdhb5 G A 18: 37,322,543 V659M probably damaging Het
Pkd1l3 C G 8: 109,623,649 D375E possibly damaging Het
Pmis2 T C 7: 30,671,392 I46V probably benign Het
Ppp2r5e A G 12: 75,462,442 probably benign Het
Prom2 A G 2: 127,528,789 F825S probably damaging Het
Rab11fip2 G A 19: 59,906,243 A524V possibly damaging Het
Rb1cc1 A C 1: 6,263,267 probably null Het
Rwdd3 G C 3: 121,159,019 Q180E possibly damaging Het
Sema6a G A 18: 47,290,045 probably null Het
Sgcg A T 14: 61,221,686 C265S probably damaging Het
Slc16a3 T C 11: 120,958,052 S445P possibly damaging Het
Slc22a3 G A 17: 12,458,493 Q263* probably null Het
Sorcs3 A G 19: 48,748,319 T694A probably benign Het
Tecta G T 9: 42,373,073 F905L probably benign Het
Tmeff1 A G 4: 48,636,853 I184V possibly damaging Het
Ttf1 A G 2: 29,065,407 H261R possibly damaging Het
Ttll6 T A 11: 96,145,591 L349M probably damaging Het
Ubac2 G A 14: 121,973,619 V134M probably damaging Het
Ubxn4 G A 1: 128,262,904 E256K probably benign Het
Vmn2r25 T G 6: 123,852,049 I89L probably benign Het
Vmn2r6 A C 3: 64,556,302 F370L probably damaging Het
Vps13b T A 15: 35,445,602 Y412* probably null Het
Zfp142 A G 1: 74,585,411 S85P possibly damaging Het
Zfp516 G A 18: 82,957,454 probably null Het
Other mutations in Tbc1d15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00337:Tbc1d15 APN 10 115209641 nonsense probably null
IGL01161:Tbc1d15 APN 10 115202530 missense probably benign 0.01
IGL02458:Tbc1d15 APN 10 115229206 missense probably damaging 0.99
IGL03145:Tbc1d15 APN 10 115202516 missense probably benign 0.03
R0140:Tbc1d15 UTSW 10 115220219 missense probably damaging 0.99
R0617:Tbc1d15 UTSW 10 115239299 missense probably damaging 1.00
R0633:Tbc1d15 UTSW 10 115220310 missense probably benign 0.00
R1526:Tbc1d15 UTSW 10 115203230 missense probably benign 0.38
R1699:Tbc1d15 UTSW 10 115220314 missense probably benign 0.05
R1727:Tbc1d15 UTSW 10 115210225 missense probably damaging 1.00
R2063:Tbc1d15 UTSW 10 115229173 missense probably benign
R2111:Tbc1d15 UTSW 10 115240914 missense possibly damaging 0.88
R4751:Tbc1d15 UTSW 10 115202587 missense probably damaging 1.00
R5318:Tbc1d15 UTSW 10 115208969 nonsense probably null
R5480:Tbc1d15 UTSW 10 115233218 missense probably damaging 1.00
R5746:Tbc1d15 UTSW 10 115210279 missense probably damaging 1.00
R5891:Tbc1d15 UTSW 10 115220308 missense probably benign 0.20
R6012:Tbc1d15 UTSW 10 115219207 missense probably damaging 1.00
R6306:Tbc1d15 UTSW 10 115233243 missense possibly damaging 0.91
R6989:Tbc1d15 UTSW 10 115209569 missense probably damaging 1.00
R7792:Tbc1d15 UTSW 10 115221587 missense possibly damaging 0.91
R8134:Tbc1d15 UTSW 10 115209569 missense probably damaging 1.00
R8231:Tbc1d15 UTSW 10 115229140 missense probably damaging 1.00
R8507:Tbc1d15 UTSW 10 115202502 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TGGACATCTGCAAACTCAGCACTC -3'
(R):5'- GCTGCCCCTAACCTTAAAACTGGAC -3'

Sequencing Primer
(F):5'- TCAGCACTCGGCACTGTAAG -3'
(R):5'- TGCCTGAGAAACAGTGTCTTAGC -3'
Posted On2013-05-23