Incidental Mutation 'R0466:G3bp1'
ID 41647
Institutional Source Beutler Lab
Gene Symbol G3bp1
Ensembl Gene ENSMUSG00000018583
Gene Name GTPase activating protein (SH3 domain) binding protein 1
Synonyms GAP SH3 binding protein
MMRRC Submission 038666-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R0466 (G1)
Quality Score 155
Status Validated
Chromosome 11
Chromosomal Location 55469685-55504838 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 55498626 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 383 (F383L)
Ref Sequence ENSEMBL: ENSMUSP00000018727 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018727]
AlphaFold P97855
Predicted Effect probably damaging
Transcript: ENSMUST00000018727
AA Change: F383L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000018727
Gene: ENSMUSG00000018583
AA Change: F383L

Pfam:NTF2 11 133 5.8e-35 PFAM
low complexity region 142 167 N/A INTRINSIC
low complexity region 187 206 N/A INTRINSIC
low complexity region 211 225 N/A INTRINSIC
low complexity region 289 305 N/A INTRINSIC
RRM 339 409 1.49e-13 SMART
low complexity region 419 447 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185156
Meta Mutation Damage Score 0.8237 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency 97% (63/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the DNA-unwinding enzymes which prefers partially unwound 3'-tailed substrates and can also unwind partial RNA/DNA and RNA/RNA duplexes in an ATP-dependent fashion. This enzyme is a member of the heterogeneous nuclear RNA-binding proteins and is also an element of the Ras signal transduction pathway. It binds specifically to the Ras-GTPase-activating protein by associating with its SH3 domain. Several alternatively spliced transcript variants of this gene have been described, but the full-length nature of some of these variants has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display perinatal lethality with severe cell death in the nervous system and decreased cell proliferation. Neonates from heterozygous null female mice display increased mortality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210407C18Rik T C 11: 58,612,505 probably benign Het
4933412E24Rik T C 15: 60,015,472 Y373C probably benign Het
Abca12 T G 1: 71,302,663 Q1046H probably damaging Het
Adgrv1 A G 13: 81,566,296 F956S probably benign Het
Alk A G 17: 71,905,157 V797A possibly damaging Het
Armc4 T A 18: 7,286,758 I158F probably benign Het
Ascl2 A G 7: 142,968,480 L77P probably benign Het
Aspm A T 1: 139,477,901 I1509F probably damaging Het
AY358078 A T 14: 51,805,632 Y259F unknown Het
Cbs G A 17: 31,616,152 A450V probably benign Het
Cdh11 T A 8: 102,670,058 Q213L possibly damaging Het
Cdh26 C T 2: 178,481,632 R675C possibly damaging Het
Cfap126 T C 1: 171,126,200 I113T probably damaging Het
Clk4 A G 11: 51,267,328 D53G possibly damaging Het
Dab1 T C 4: 104,720,550 L272P probably benign Het
Dmtf1 A T 5: 9,132,454 probably null Het
Dph5 A C 3: 115,928,710 D279A probably benign Het
Fbxw19 T A 9: 109,478,649 T461S probably benign Het
Gcg T C 2: 62,476,938 D93G probably damaging Het
Gmps A G 3: 63,993,944 T395A probably damaging Het
H2-Ob A G 17: 34,242,659 D124G probably damaging Het
Itga8 G T 2: 12,232,886 A341E probably damaging Het
Itih3 A G 14: 30,912,874 probably null Het
Kcnh4 C T 11: 100,746,932 G633E probably benign Het
Kif2c C T 4: 117,172,292 R215Q possibly damaging Het
Letm1 A C 5: 33,761,730 probably benign Het
Mmp3 A G 9: 7,450,165 D299G probably damaging Het
Myh8 G T 11: 67,298,579 A1194S probably benign Het
Naip2 A C 13: 100,161,782 I582S probably benign Het
Nfib A C 4: 82,498,538 Y87D probably damaging Het
Nlrp4a T C 7: 26,462,620 probably benign Het
Nsmce1 A T 7: 125,472,236 probably benign Het
Olfr834 T G 9: 18,988,255 V89G probably benign Het
Olfr845 A T 9: 19,339,179 T240S probably damaging Het
Patj C A 4: 98,688,156 Q1193K probably damaging Het
Pcdhb5 G A 18: 37,322,543 V659M probably damaging Het
Pkd1l3 C G 8: 109,623,649 D375E possibly damaging Het
Pmis2 T C 7: 30,671,392 I46V probably benign Het
Ppp2r5e A G 12: 75,462,442 probably benign Het
Prom2 A G 2: 127,528,789 F825S probably damaging Het
Rab11fip2 G A 19: 59,906,243 A524V possibly damaging Het
Rb1cc1 A C 1: 6,263,267 probably null Het
Rwdd3 G C 3: 121,159,019 Q180E possibly damaging Het
Sema6a G A 18: 47,290,045 probably null Het
Sgcg A T 14: 61,221,686 C265S probably damaging Het
Slc16a3 T C 11: 120,958,052 S445P possibly damaging Het
Slc22a3 G A 17: 12,458,493 Q263* probably null Het
Sorcs3 A G 19: 48,748,319 T694A probably benign Het
Tbc1d15 T C 10: 115,219,172 K322E probably damaging Het
Tecta G T 9: 42,373,073 F905L probably benign Het
Tmeff1 A G 4: 48,636,853 I184V possibly damaging Het
Ttf1 A G 2: 29,065,407 H261R possibly damaging Het
Ttll6 T A 11: 96,145,591 L349M probably damaging Het
Ubac2 G A 14: 121,973,619 V134M probably damaging Het
Ubxn4 G A 1: 128,262,904 E256K probably benign Het
Vmn2r25 T G 6: 123,852,049 I89L probably benign Het
Vmn2r6 A C 3: 64,556,302 F370L probably damaging Het
Vps13b T A 15: 35,445,602 Y412* probably null Het
Zfp142 A G 1: 74,585,411 S85P possibly damaging Het
Zfp516 G A 18: 82,957,454 probably null Het
Other mutations in G3bp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02231:G3bp1 APN 11 55495447 nonsense probably null
silverheels UTSW 11 55489116 missense possibly damaging 0.95
R0056:G3bp1 UTSW 11 55498041 missense probably benign 0.03
R0113:G3bp1 UTSW 11 55495426 missense probably benign 0.00
R0240:G3bp1 UTSW 11 55492028 missense probably damaging 1.00
R0240:G3bp1 UTSW 11 55492028 missense probably damaging 1.00
R0311:G3bp1 UTSW 11 55498626 missense probably damaging 1.00
R0312:G3bp1 UTSW 11 55498626 missense probably damaging 1.00
R0367:G3bp1 UTSW 11 55498626 missense probably damaging 1.00
R0368:G3bp1 UTSW 11 55498626 missense probably damaging 1.00
R0454:G3bp1 UTSW 11 55498626 missense probably damaging 1.00
R0464:G3bp1 UTSW 11 55498626 missense probably damaging 1.00
R0465:G3bp1 UTSW 11 55498626 missense probably damaging 1.00
R0467:G3bp1 UTSW 11 55498626 missense probably damaging 1.00
R0486:G3bp1 UTSW 11 55498626 missense probably damaging 1.00
R0487:G3bp1 UTSW 11 55498626 missense probably damaging 1.00
R0533:G3bp1 UTSW 11 55498626 missense probably damaging 1.00
R0551:G3bp1 UTSW 11 55489143 missense probably benign 0.01
R0689:G3bp1 UTSW 11 55498626 missense probably damaging 1.00
R0848:G3bp1 UTSW 11 55498626 missense probably damaging 1.00
R2109:G3bp1 UTSW 11 55489160 missense probably damaging 0.97
R5129:G3bp1 UTSW 11 55489116 missense possibly damaging 0.95
R5439:G3bp1 UTSW 11 55497987 missense probably damaging 0.96
R5834:G3bp1 UTSW 11 55497940 missense probably benign
R6692:G3bp1 UTSW 11 55493509 missense probably benign 0.00
R6925:G3bp1 UTSW 11 55497960 missense possibly damaging 0.47
R7091:G3bp1 UTSW 11 55496221 missense possibly damaging 0.94
R8348:G3bp1 UTSW 11 55498631 missense possibly damaging 0.81
R9375:G3bp1 UTSW 11 55499613 missense probably damaging 0.99
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- acaataggtaactccatgtccag -3'
Posted On 2013-05-23