Mutagenetix > Incidental Mutation

Incidental Mutation 'R0466:G3bp1'

41647

Institutional Source

Beutler Lab

Gene Symbol

G3bp1

Ensembl Gene

ENSMUSG00000018583

Gene Name

GTPase activating protein (SH3 domain) binding protein 1

Synonyms

GAP SH3 binding protein

MMRRC Submission

038666-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R0466 (G1)

Quality Score

155

Status

Validated

Chromosome

Chromosomal Location

55469685-55504838 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 55498626 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Leucine at position 383 (F383L)

Ref Sequence

ENSEMBL: ENSMUSP00000018727 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000018727]

AlphaFold

P97855

Predicted Effect

probably damaging
Transcript: ENSMUST00000018727
AA Change: F383L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000018727
Gene: ENSMUSG00000018583
AA Change: F383L

Domain	Start	End	E-Value	Type
Pfam:NTF2	11	133	5.8e-35	PFAM
low complexity region	142	167	N/A	INTRINSIC
low complexity region	187	206	N/A	INTRINSIC
low complexity region	211	225	N/A	INTRINSIC
low complexity region	289	305	N/A	INTRINSIC
RRM	339	409	1.49e-13	SMART
low complexity region	419	447	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000185156

Meta Mutation Damage Score

0.8237

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.8%
20x: 94.1%

Validation Efficiency

97% (63/65)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the DNA-unwinding enzymes which prefers partially unwound 3'-tailed substrates and can also unwind partial RNA/DNA and RNA/RNA duplexes in an ATP-dependent fashion. This enzyme is a member of the heterogeneous nuclear RNA-binding proteins and is also an element of the Ras signal transduction pathway. It binds specifically to the Ras-GTPase-activating protein by associating with its SH3 domain. Several alternatively spliced transcript variants of this gene have been described, but the full-length nature of some of these variants has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display perinatal lethality with severe cell death in the nervous system and decreased cell proliferation. Neonates from heterozygous null female mice display increased mortality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2210407C18Rik	T	C	11: 58,612,505		probably benign	Het
4933412E24Rik	T	C	15: 60,015,472	Y373C	probably benign	Het
Abca12	T	G	1: 71,302,663	Q1046H	probably damaging	Het
Adgrv1	A	G	13: 81,566,296	F956S	probably benign	Het
Alk	A	G	17: 71,905,157	V797A	possibly damaging	Het
Armc4	T	A	18: 7,286,758	I158F	probably benign	Het
Ascl2	A	G	7: 142,968,480	L77P	probably benign	Het
Aspm	A	T	1: 139,477,901	I1509F	probably damaging	Het
AY358078	A	T	14: 51,805,632	Y259F	unknown	Het
Cbs	G	A	17: 31,616,152	A450V	probably benign	Het
Cdh11	T	A	8: 102,670,058	Q213L	possibly damaging	Het
Cdh26	C	T	2: 178,481,632	R675C	possibly damaging	Het
Cfap126	T	C	1: 171,126,200	I113T	probably damaging	Het
Clk4	A	G	11: 51,267,328	D53G	possibly damaging	Het
Dab1	T	C	4: 104,720,550	L272P	probably benign	Het
Dmtf1	A	T	5: 9,132,454		probably null	Het
Dph5	A	C	3: 115,928,710	D279A	probably benign	Het
Fbxw19	T	A	9: 109,478,649	T461S	probably benign	Het
Gcg	T	C	2: 62,476,938	D93G	probably damaging	Het
Gmps	A	G	3: 63,993,944	T395A	probably damaging	Het
H2-Ob	A	G	17: 34,242,659	D124G	probably damaging	Het
Itga8	G	T	2: 12,232,886	A341E	probably damaging	Het
Itih3	A	G	14: 30,912,874		probably null	Het
Kcnh4	C	T	11: 100,746,932	G633E	probably benign	Het
Kif2c	C	T	4: 117,172,292	R215Q	possibly damaging	Het
Letm1	A	C	5: 33,761,730		probably benign	Het
Mmp3	A	G	9: 7,450,165	D299G	probably damaging	Het
Myh8	G	T	11: 67,298,579	A1194S	probably benign	Het
Naip2	A	C	13: 100,161,782	I582S	probably benign	Het
Nfib	A	C	4: 82,498,538	Y87D	probably damaging	Het
Nlrp4a	T	C	7: 26,462,620		probably benign	Het
Nsmce1	A	T	7: 125,472,236		probably benign	Het
Olfr834	T	G	9: 18,988,255	V89G	probably benign	Het
Olfr845	A	T	9: 19,339,179	T240S	probably damaging	Het
Patj	C	A	4: 98,688,156	Q1193K	probably damaging	Het
Pcdhb5	G	A	18: 37,322,543	V659M	probably damaging	Het
Pkd1l3	C	G	8: 109,623,649	D375E	possibly damaging	Het
Pmis2	T	C	7: 30,671,392	I46V	probably benign	Het
Ppp2r5e	A	G	12: 75,462,442		probably benign	Het
Prom2	A	G	2: 127,528,789	F825S	probably damaging	Het
Rab11fip2	G	A	19: 59,906,243	A524V	possibly damaging	Het
Rb1cc1	A	C	1: 6,263,267		probably null	Het
Rwdd3	G	C	3: 121,159,019	Q180E	possibly damaging	Het
Sema6a	G	A	18: 47,290,045		probably null	Het
Sgcg	A	T	14: 61,221,686	C265S	probably damaging	Het
Slc16a3	T	C	11: 120,958,052	S445P	possibly damaging	Het
Slc22a3	G	A	17: 12,458,493	Q263*	probably null	Het
Sorcs3	A	G	19: 48,748,319	T694A	probably benign	Het
Tbc1d15	T	C	10: 115,219,172	K322E	probably damaging	Het
Tecta	G	T	9: 42,373,073	F905L	probably benign	Het
Tmeff1	A	G	4: 48,636,853	I184V	possibly damaging	Het
Ttf1	A	G	2: 29,065,407	H261R	possibly damaging	Het
Ttll6	T	A	11: 96,145,591	L349M	probably damaging	Het
Ubac2	G	A	14: 121,973,619	V134M	probably damaging	Het
Ubxn4	G	A	1: 128,262,904	E256K	probably benign	Het
Vmn2r25	T	G	6: 123,852,049	I89L	probably benign	Het
Vmn2r6	A	C	3: 64,556,302	F370L	probably damaging	Het
Vps13b	T	A	15: 35,445,602	Y412*	probably null	Het
Zfp142	A	G	1: 74,585,411	S85P	possibly damaging	Het
Zfp516	G	A	18: 82,957,454		probably null	Het

Other mutations in G3bp1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02231:G3bp1	APN	11	55495447	nonsense	probably null
silverheels	UTSW	11	55489116	missense	possibly damaging	0.95
R0056:G3bp1	UTSW	11	55498041	missense	probably benign	0.03
R0113:G3bp1	UTSW	11	55495426	missense	probably benign	0.00
R0240:G3bp1	UTSW	11	55492028	missense	probably damaging	1.00
R0240:G3bp1	UTSW	11	55492028	missense	probably damaging	1.00
R0311:G3bp1	UTSW	11	55498626	missense	probably damaging	1.00
R0312:G3bp1	UTSW	11	55498626	missense	probably damaging	1.00
R0367:G3bp1	UTSW	11	55498626	missense	probably damaging	1.00
R0368:G3bp1	UTSW	11	55498626	missense	probably damaging	1.00
R0454:G3bp1	UTSW	11	55498626	missense	probably damaging	1.00
R0464:G3bp1	UTSW	11	55498626	missense	probably damaging	1.00
R0465:G3bp1	UTSW	11	55498626	missense	probably damaging	1.00
R0467:G3bp1	UTSW	11	55498626	missense	probably damaging	1.00
R0486:G3bp1	UTSW	11	55498626	missense	probably damaging	1.00
R0487:G3bp1	UTSW	11	55498626	missense	probably damaging	1.00
R0533:G3bp1	UTSW	11	55498626	missense	probably damaging	1.00
R0551:G3bp1	UTSW	11	55489143	missense	probably benign	0.01
R0689:G3bp1	UTSW	11	55498626	missense	probably damaging	1.00
R0848:G3bp1	UTSW	11	55498626	missense	probably damaging	1.00
R2109:G3bp1	UTSW	11	55489160	missense	probably damaging	0.97
R5129:G3bp1	UTSW	11	55489116	missense	possibly damaging	0.95
R5439:G3bp1	UTSW	11	55497987	missense	probably damaging	0.96
R5834:G3bp1	UTSW	11	55497940	missense	probably benign
R6692:G3bp1	UTSW	11	55493509	missense	probably benign	0.00
R6925:G3bp1	UTSW	11	55497960	missense	possibly damaging	0.47
R7091:G3bp1	UTSW	11	55496221	missense	possibly damaging	0.94
R8348:G3bp1	UTSW	11	55498631	missense	possibly damaging	0.81
R9375:G3bp1	UTSW	11	55499613	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TGAGACACAATGCCTTGCCCAC -3'
(R):5'- TCCGAGCTGGAAAATGACACTCAAC -3'

Sequencing Primer
(F):5'- CATCTAAGGAGCTTATCATTGAACTC -3'
(R):5'- acaataggtaactccatgtccag -3'

Posted On

2013-05-23