Incidental Mutation 'R0466:Sgcg'
ID41657
Institutional Source Beutler Lab
Gene Symbol Sgcg
Ensembl Gene ENSMUSG00000035296
Gene Namesarcoglycan, gamma (dystrophin-associated glycoprotein)
Synonymsgamma-SG, 5430420E18Rik
MMRRC Submission 038666-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.197) question?
Stock #R0466 (G1)
Quality Score210
Status Validated
Chromosome14
Chromosomal Location61219115-61258490 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 61221686 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 265 (C265S)
Ref Sequence ENSEMBL: ENSMUSP00000112576 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077954] [ENSMUST00000089394] [ENSMUST00000121148]
Predicted Effect probably damaging
Transcript: ENSMUST00000077954
AA Change: C265S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000077106
Gene: ENSMUSG00000035296
AA Change: C265S

DomainStartEndE-ValueType
Pfam:Sarcoglycan_1 25 280 1.2e-81 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000089394
SMART Domains Protein: ENSMUSP00000086816
Gene: ENSMUSG00000048279

DomainStartEndE-ValueType
SCOP:d1lm8b_ 8 66 3e-3 SMART
Blast:UBQ 9 81 3e-31 BLAST
Blast:HATPase_c 116 211 2e-10 BLAST
low complexity region 608 623 N/A INTRINSIC
low complexity region 664 673 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000121148
AA Change: C265S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112576
Gene: ENSMUSG00000035296
AA Change: C265S

DomainStartEndE-ValueType
Pfam:Sarcoglycan_1 23 284 1.1e-106 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129886
SMART Domains Protein: ENSMUSP00000117191
Gene: ENSMUSG00000035296

DomainStartEndE-ValueType
Pfam:Sarcoglycan_1 1 81 8e-20 PFAM
Meta Mutation Damage Score 0.9449 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency 97% (63/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes gamma-sarcoglycan, one of several sarcolemmal transmembrane glycoproteins that interact with dystrophin. The dystrophin-glycoprotein complex (DGC) spans the sarcolemma and is comprised of dystrophin, syntrophin, alpha- and beta-dystroglycans and sarcoglycans. The DGC provides a structural link between the subsarcolemmal cytoskeleton and the extracellular matrix of muscle cells. Defects in the encoded protein can lead to early onset autosomal recessive muscular dystrophy, in particular limb-girdle muscular dystrophy, type 2C (LGMD2C). [provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene display abnormalities in muscles and heart similar to muscular dystrophy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210407C18Rik T C 11: 58,612,505 probably benign Het
4933412E24Rik T C 15: 60,015,472 Y373C probably benign Het
Abca12 T G 1: 71,302,663 Q1046H probably damaging Het
Adgrv1 A G 13: 81,566,296 F956S probably benign Het
Alk A G 17: 71,905,157 V797A possibly damaging Het
Armc4 T A 18: 7,286,758 I158F probably benign Het
Ascl2 A G 7: 142,968,480 L77P probably benign Het
Aspm A T 1: 139,477,901 I1509F probably damaging Het
AY358078 A T 14: 51,805,632 Y259F unknown Het
Cbs G A 17: 31,616,152 A450V probably benign Het
Cdh11 T A 8: 102,670,058 Q213L possibly damaging Het
Cdh26 C T 2: 178,481,632 R675C possibly damaging Het
Cfap126 T C 1: 171,126,200 I113T probably damaging Het
Clk4 A G 11: 51,267,328 D53G possibly damaging Het
Dab1 T C 4: 104,720,550 L272P probably benign Het
Dmtf1 A T 5: 9,132,454 probably null Het
Dph5 A C 3: 115,928,710 D279A probably benign Het
Fbxw19 T A 9: 109,478,649 T461S probably benign Het
G3bp1 T C 11: 55,498,626 F383L probably damaging Het
Gcg T C 2: 62,476,938 D93G probably damaging Het
Gmps A G 3: 63,993,944 T395A probably damaging Het
H2-Ob A G 17: 34,242,659 D124G probably damaging Het
Itga8 G T 2: 12,232,886 A341E probably damaging Het
Itih3 A G 14: 30,912,874 probably null Het
Kcnh4 C T 11: 100,746,932 G633E probably benign Het
Kif2c C T 4: 117,172,292 R215Q possibly damaging Het
Letm1 A C 5: 33,761,730 probably benign Het
Mmp3 A G 9: 7,450,165 D299G probably damaging Het
Myh8 G T 11: 67,298,579 A1194S probably benign Het
Naip2 A C 13: 100,161,782 I582S probably benign Het
Nfib A C 4: 82,498,538 Y87D probably damaging Het
Nlrp4a T C 7: 26,462,620 probably benign Het
Nsmce1 A T 7: 125,472,236 probably benign Het
Olfr834 T G 9: 18,988,255 V89G probably benign Het
Olfr845 A T 9: 19,339,179 T240S probably damaging Het
Patj C A 4: 98,688,156 Q1193K probably damaging Het
Pcdhb5 G A 18: 37,322,543 V659M probably damaging Het
Pkd1l3 C G 8: 109,623,649 D375E possibly damaging Het
Pmis2 T C 7: 30,671,392 I46V probably benign Het
Ppp2r5e A G 12: 75,462,442 probably benign Het
Prom2 A G 2: 127,528,789 F825S probably damaging Het
Rab11fip2 G A 19: 59,906,243 A524V possibly damaging Het
Rb1cc1 A C 1: 6,263,267 probably null Het
Rwdd3 G C 3: 121,159,019 Q180E possibly damaging Het
Sema6a G A 18: 47,290,045 probably null Het
Slc16a3 T C 11: 120,958,052 S445P possibly damaging Het
Slc22a3 G A 17: 12,458,493 Q263* probably null Het
Sorcs3 A G 19: 48,748,319 T694A probably benign Het
Tbc1d15 T C 10: 115,219,172 K322E probably damaging Het
Tecta G T 9: 42,373,073 F905L probably benign Het
Tmeff1 A G 4: 48,636,853 I184V possibly damaging Het
Ttf1 A G 2: 29,065,407 H261R possibly damaging Het
Ttll6 T A 11: 96,145,591 L349M probably damaging Het
Ubac2 G A 14: 121,973,619 V134M probably damaging Het
Ubxn4 G A 1: 128,262,904 E256K probably benign Het
Vmn2r25 T G 6: 123,852,049 I89L probably benign Het
Vmn2r6 A C 3: 64,556,302 F370L probably damaging Het
Vps13b T A 15: 35,445,602 Y412* probably null Het
Zfp142 A G 1: 74,585,411 S85P possibly damaging Het
Zfp516 G A 18: 82,957,454 probably null Het
Other mutations in Sgcg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Sgcg APN 14 61240347 nonsense probably null
IGL00159:Sgcg APN 14 61232475 missense probably benign 0.00
R1236:Sgcg UTSW 14 61245770 missense probably damaging 0.99
R1870:Sgcg UTSW 14 61240447 splice site probably benign
R1879:Sgcg UTSW 14 61236897 critical splice acceptor site probably null
R1933:Sgcg UTSW 14 61232412 missense possibly damaging 0.77
R2090:Sgcg UTSW 14 61245764 missense probably damaging 0.99
R2937:Sgcg UTSW 14 61229625 missense probably damaging 1.00
R2938:Sgcg UTSW 14 61229625 missense probably damaging 1.00
R3508:Sgcg UTSW 14 61221746 missense probably benign
R5345:Sgcg UTSW 14 61245769 missense probably damaging 0.99
R5464:Sgcg UTSW 14 61236855 missense possibly damaging 0.65
R5582:Sgcg UTSW 14 61225305 missense probably damaging 1.00
R7259:Sgcg UTSW 14 61225217 missense probably benign 0.30
R7335:Sgcg UTSW 14 61240367 missense probably damaging 1.00
R8339:Sgcg UTSW 14 61232517 missense probably benign
Predicted Primers PCR Primer
(F):5'- TTTAGCAATGAGCCCTCCAGCTCC -3'
(R):5'- TCAGCCTGACCTGCACAAAGAATAG -3'

Sequencing Primer
(F):5'- GCCCTCCAGCTCCAATCC -3'
(R):5'- ggaacccagctcggaac -3'
Posted On2013-05-23