Incidental Mutation 'R0467:Shcbp1l'
ID41676
Institutional Source Beutler Lab
Gene Symbol Shcbp1l
Ensembl Gene ENSMUSG00000042708
Gene NameShc SH2-domain binding protein 1-like
Synonyms1700012A16Rik
MMRRC Submission 038667-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.292) question?
Stock #R0467 (G1)
Quality Score156
Status Validated
Chromosome1
Chromosomal Location153425162-153452574 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 153433182 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 174 (C174Y)
Ref Sequence ENSEMBL: ENSMUSP00000137625 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042373] [ENSMUST00000136614]
Predicted Effect probably damaging
Transcript: ENSMUST00000042373
AA Change: C174Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000036347
Gene: ENSMUSG00000042708
AA Change: C174Y

DomainStartEndE-ValueType
low complexity region 42 54 N/A INTRINSIC
CASH 362 522 2.85e-8 SMART
PbH1 479 500 2.3e3 SMART
PbH1 501 523 5.74e1 SMART
PbH1 524 557 2.3e3 SMART
PbH1 560 582 1.56e0 SMART
low complexity region 603 608 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000136614
AA Change: C174Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000137625
Gene: ENSMUSG00000042708
AA Change: C174Y

DomainStartEndE-ValueType
low complexity region 42 54 N/A INTRINSIC
Meta Mutation Damage Score 0.5720 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 96.7%
  • 20x: 93.3%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a Src homology 2 domain-binding protein 1-like protein. The encoded protein interacts with heat shock 70 kDa protein 2 and may be involved in maintaining spindle integrity during meiosis. This gene is located in region of chromoso0me 1 encompassing a prostate cancer susceptibility locus. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced male fertility with reduced sperm, increased male germ cell apoptosis and spindle instability. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik T C 4: 42,972,715 S683P probably benign Het
2310007B03Rik A T 1: 93,153,044 I380N probably damaging Het
4931423N10Rik A G 2: 23,212,820 E190G possibly damaging Het
4933416C03Rik G A 10: 116,113,153 A156V probably benign Het
Abca17 A G 17: 24,313,177 probably benign Het
Anapc1 A G 2: 128,669,043 I511T probably damaging Het
Atf6 A T 1: 170,794,020 H477Q probably damaging Het
C4b A G 17: 34,736,127 V795A probably benign Het
Cdh26 C T 2: 178,481,632 R675C possibly damaging Het
Cdk12 T C 11: 98,203,579 V71A probably damaging Het
Cul3 A T 1: 80,280,863 D419E probably benign Het
Ddi2 A G 4: 141,685,184 I139T probably benign Het
Dnaaf1 T A 8: 119,590,732 D333E probably benign Het
Dnase1 A G 16: 4,039,149 D7G probably damaging Het
Fam71f1 G A 6: 29,326,607 S241N probably damaging Het
G3bp1 T C 11: 55,498,626 F383L probably damaging Het
Galc A C 12: 98,242,645 I250R probably damaging Het
Gcfc2 T C 6: 81,923,882 V59A possibly damaging Het
Gm6133 A C 18: 78,350,090 S100R probably benign Het
Iba57 T C 11: 59,163,439 T85A probably benign Het
Ipo4 A T 14: 55,635,526 M1K probably null Het
Ippk A G 13: 49,430,865 probably null Het
Kcnk10 A T 12: 98,489,945 I209N probably benign Het
Klk14 T C 7: 43,694,110 L122P probably benign Het
Ltbp1 T A 17: 75,282,429 probably null Het
Mcm3 T C 1: 20,804,847 D737G probably benign Het
Naip2 A C 13: 100,161,782 I582S probably benign Het
Nalcn T A 14: 123,291,047 T1456S probably benign Het
Nckap1l C T 15: 103,497,427 P1097S probably benign Het
Ncoa1 A G 12: 4,267,687 M1215T possibly damaging Het
Nomo1 T A 7: 46,072,487 probably null Het
Obox5 T A 7: 15,758,007 C116S possibly damaging Het
Olfr644 C T 7: 104,068,125 R302H probably benign Het
Olfr701 T A 7: 106,818,361 S93T possibly damaging Het
Olfr76 C A 19: 12,120,536 A59S probably benign Het
Pcdhb14 G T 18: 37,449,224 R461L probably damaging Het
Pdgfra A G 5: 75,195,036 D1069G probably damaging Het
Pgr C T 9: 8,900,778 A104V possibly damaging Het
Pkd1l3 C G 8: 109,623,649 D375E possibly damaging Het
Rassf3 A G 10: 121,417,204 probably benign Het
Rgs22 G T 15: 36,099,795 S258* probably null Het
Rsph6a C A 7: 19,057,669 D254E possibly damaging Het
Sgk1 A G 10: 21,996,358 probably benign Het
Sulf1 T A 1: 12,796,920 N109K probably damaging Het
Tas2r115 T A 6: 132,737,719 I90L probably benign Het
Tmem200a T C 10: 25,994,104 H89R probably benign Het
Ubxn4 G A 1: 128,262,904 E256K probably benign Het
Xrn1 T C 9: 96,024,191 S1212P probably damaging Het
Zfp408 T C 2: 91,645,537 Y424C possibly damaging Het
Other mutations in Shcbp1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00228:Shcbp1l APN 1 153435807 missense possibly damaging 0.79
IGL01067:Shcbp1l APN 1 153436024 missense possibly damaging 0.49
IGL02292:Shcbp1l APN 1 153436145 splice site probably benign
IGL02588:Shcbp1l APN 1 153428665 missense probably benign 0.05
IGL03220:Shcbp1l APN 1 153433165 splice site probably benign
R0534:Shcbp1l UTSW 1 153428568 missense possibly damaging 0.78
R1192:Shcbp1l UTSW 1 153425507 missense possibly damaging 0.60
R2878:Shcbp1l UTSW 1 153437518 splice site probably benign
R2910:Shcbp1l UTSW 1 153428626 missense probably damaging 0.98
R2911:Shcbp1l UTSW 1 153428626 missense probably damaging 0.98
R3080:Shcbp1l UTSW 1 153436037 missense possibly damaging 0.95
R3854:Shcbp1l UTSW 1 153452444 missense probably damaging 1.00
R7373:Shcbp1l UTSW 1 153425240 missense probably benign 0.07
R7793:Shcbp1l UTSW 1 153447825 missense probably benign 0.00
Z1176:Shcbp1l UTSW 1 153452274 missense probably damaging 1.00
Z1176:Shcbp1l UTSW 1 153452385 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGGAGGTGCTTGAAAACCTGTTGG -3'
(R):5'- ACGGGTAAATTGAACCCATCAGTCTCA -3'

Sequencing Primer
(F):5'- AACCTGTTGGTATTTAATGTCTATCC -3'
(R):5'- AGCAATGTCTCGGACATCG -3'
Posted On2013-05-23