Mutagenetix > Incidental Mutation

Incidental Mutation 'R0467:Atf6'

41677

Institutional Source

Beutler Lab

Gene Symbol

Atf6

Ensembl Gene

ENSMUSG00000026663

Gene Name

activating transcription factor 6

Synonyms

9130025P16Rik, ESTM49, Atf6alpha

MMRRC Submission

038667-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.139) question?

Stock #

R0467 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

170704674-170867771 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 170794020 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Glutamine at position 477 (H477Q)

Ref Sequence

ENSEMBL: ENSMUSP00000027974 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027974]

AlphaFold

F6VAN0

Predicted Effect

probably damaging
Transcript: ENSMUST00000027974
AA Change: H477Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000027974
Gene: ENSMUSG00000026663
AA Change: H477Q

Domain	Start	End	E-Value	Type
low complexity region	78	101	N/A	INTRINSIC
low complexity region	109	121	N/A	INTRINSIC
low complexity region	168	178	N/A	INTRINSIC
BRLZ	291	355	2.72e-16	SMART
Blast:BRLZ	384	419	5e-6	BLAST
low complexity region	445	457	N/A	INTRINSIC
low complexity region	631	650	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000182787

Meta Mutation Damage Score

0.3197

Coding Region Coverage

1x: 99.6%
3x: 98.8%
10x: 96.7%
20x: 93.3%

Validation Efficiency

98% (52/53)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcription factor that activates target genes for the unfolded protein response (UPR) during endoplasmic reticulum (ER) stress. Although it is a transcription factor, this protein is unusual in that it is synthesized as a transmembrane protein that is embedded in the ER. It functions as an ER stress sensor/transducer, and following ER stress-induced proteolysis, it functions as a nuclear transcription factor via a cis-acting ER stress response element (ERSE) that is present in the promoters of genes encoding ER chaperones. This protein has been identified as a survival factor for quiescent but not proliferative squamous carcinoma cells. There have been conflicting reports about the association of polymorphisms in this gene with diabetes in different populations, but another polymorphism has been associated with increased plasma cholesterol levels. This gene is also thought to be a potential therapeutic target for cystic fibrosis. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a null allele exhibit increased sensitivity to dithiothreitol, thapsigargin, and tunicamycin. Mice homozygous for a conditional allele activated in islet cells exhibit reduced sensitivity to TUDCA. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700022I11Rik	T	C	4: 42,972,715	S683P	probably benign	Het
2310007B03Rik	A	T	1: 93,153,044	I380N	probably damaging	Het
4931423N10Rik	A	G	2: 23,212,820	E190G	possibly damaging	Het
4933416C03Rik	G	A	10: 116,113,153	A156V	probably benign	Het
Abca17	A	G	17: 24,313,177		probably benign	Het
Anapc1	A	G	2: 128,669,043	I511T	probably damaging	Het
C4b	A	G	17: 34,736,127	V795A	probably benign	Het
Cdh26	C	T	2: 178,481,632	R675C	possibly damaging	Het
Cdk12	T	C	11: 98,203,579	V71A	probably damaging	Het
Cul3	A	T	1: 80,280,863	D419E	probably benign	Het
Ddi2	A	G	4: 141,685,184	I139T	probably benign	Het
Dnaaf1	T	A	8: 119,590,732	D333E	probably benign	Het
Dnase1	A	G	16: 4,039,149	D7G	probably damaging	Het
Fam71f1	G	A	6: 29,326,607	S241N	probably damaging	Het
G3bp1	T	C	11: 55,498,626	F383L	probably damaging	Het
Galc	A	C	12: 98,242,645	I250R	probably damaging	Het
Gcfc2	T	C	6: 81,923,882	V59A	possibly damaging	Het
Gm6133	A	C	18: 78,350,090	S100R	probably benign	Het
Iba57	T	C	11: 59,163,439	T85A	probably benign	Het
Ipo4	A	T	14: 55,635,526	M1K	probably null	Het
Ippk	A	G	13: 49,430,865		probably null	Het
Kcnk10	A	T	12: 98,489,945	I209N	probably benign	Het
Klk14	T	C	7: 43,694,110	L122P	probably benign	Het
Ltbp1	T	A	17: 75,282,429		probably null	Het
Mcm3	T	C	1: 20,804,847	D737G	probably benign	Het
Naip2	A	C	13: 100,161,782	I582S	probably benign	Het
Nalcn	T	A	14: 123,291,047	T1456S	probably benign	Het
Nckap1l	C	T	15: 103,497,427	P1097S	probably benign	Het
Ncoa1	A	G	12: 4,267,687	M1215T	possibly damaging	Het
Nomo1	T	A	7: 46,072,487		probably null	Het
Obox5	T	A	7: 15,758,007	C116S	possibly damaging	Het
Olfr644	C	T	7: 104,068,125	R302H	probably benign	Het
Olfr701	T	A	7: 106,818,361	S93T	possibly damaging	Het
Olfr76	C	A	19: 12,120,536	A59S	probably benign	Het
Pcdhb14	G	T	18: 37,449,224	R461L	probably damaging	Het
Pdgfra	A	G	5: 75,195,036	D1069G	probably damaging	Het
Pgr	C	T	9: 8,900,778	A104V	possibly damaging	Het
Pkd1l3	C	G	8: 109,623,649	D375E	possibly damaging	Het
Rassf3	A	G	10: 121,417,204		probably benign	Het
Rgs22	G	T	15: 36,099,795	S258*	probably null	Het
Rsph6a	C	A	7: 19,057,669	D254E	possibly damaging	Het
Sgk1	A	G	10: 21,996,358		probably benign	Het
Shcbp1l	G	A	1: 153,433,182	C174Y	probably damaging	Het
Sulf1	T	A	1: 12,796,920	N109K	probably damaging	Het
Tas2r115	T	A	6: 132,737,719	I90L	probably benign	Het
Tmem200a	T	C	10: 25,994,104	H89R	probably benign	Het
Ubxn4	G	A	1: 128,262,904	E256K	probably benign	Het
Xrn1	T	C	9: 96,024,191	S1212P	probably damaging	Het
Zfp408	T	C	2: 91,645,537	Y424C	possibly damaging	Het

Other mutations in Atf6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01327:Atf6	APN	1	170788606	critical splice donor site	probably null
IGL01431:Atf6	APN	1	170853002	splice site	probably benign
IGL01755:Atf6	APN	1	170788611	missense	possibly damaging	0.63
IGL02060:Atf6	APN	1	170819420	missense	probably damaging	0.99
IGL02416:Atf6	APN	1	170747157	nonsense	probably null
IGL02903:Atf6	APN	1	170799714	missense	probably benign	0.00
IGL02989:Atf6	APN	1	170788683	splice site	probably benign
IGL03209:Atf6	APN	1	170834894	missense	probably benign
R0455:Atf6	UTSW	1	170834923	missense	probably benign	0.00
R0491:Atf6	UTSW	1	170787344	critical splice donor site	probably null
R0784:Atf6	UTSW	1	170709947	missense	probably benign	0.19
R1486:Atf6	UTSW	1	170794691	missense	probably damaging	1.00
R1850:Atf6	UTSW	1	170819286	missense	probably damaging	1.00
R1945:Atf6	UTSW	1	170855141	missense	probably benign	0.00
R2164:Atf6	UTSW	1	170794735	missense	probably damaging	1.00
R3782:Atf6	UTSW	1	170794767	nonsense	probably null
R4454:Atf6	UTSW	1	170794039	missense	probably damaging	0.99
R4631:Atf6	UTSW	1	170747197	splice site	probably null
R4676:Atf6	UTSW	1	170787410	missense	probably damaging	1.00
R5772:Atf6	UTSW	1	170747189	missense	probably damaging	1.00
R5860:Atf6	UTSW	1	170841775	missense	probably damaging	1.00
R5860:Atf6	UTSW	1	170841776	missense	possibly damaging	0.95
R5950:Atf6	UTSW	1	170834879	missense	probably damaging	1.00
R6242:Atf6	UTSW	1	170793976	missense	possibly damaging	0.46
R6520:Atf6	UTSW	1	170867669	missense	probably benign	0.00
R7032:Atf6	UTSW	1	170799612	critical splice donor site	probably null
R7472:Atf6	UTSW	1	170815491	missense	possibly damaging	0.83
R7923:Atf6	UTSW	1	170794706	missense	probably benign
R8002:Atf6	UTSW	1	170819254	missense	probably benign	0.43
R8860:Atf6	UTSW	1	170852966	missense	probably null	0.95
R8956:Atf6	UTSW	1	170794007	missense	probably damaging	0.98
R9090:Atf6	UTSW	1	170794676	missense	probably damaging	1.00
R9271:Atf6	UTSW	1	170794676	missense	probably damaging	1.00
R9323:Atf6	UTSW	1	170855113	nonsense	probably null
R9500:Atf6	UTSW	1	170747139	missense	probably damaging	0.98
R9594:Atf6	UTSW	1	170840833	missense	probably benign	0.18
R9733:Atf6	UTSW	1	170834833	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- GCTGAAGTTCCCAAATCTCCCAGG -3'
(R):5'- AATTGTCCAGGTAGCGATGGTGATG -3'

Sequencing Primer
(F):5'- CTCCCAGGGAAGAAAGCAAGTC -3'
(R):5'- GGCTAGACTTGTGGACTTAATATTC -3'

Posted On

2013-05-23