Mutagenetix > Incidental Mutation

Incidental Mutation 'R0467:Anapc1'

41680

Institutional Source

Beutler Lab

Gene Symbol

Anapc1

Ensembl Gene

ENSMUSG00000014355

Gene Name

anaphase promoting complex subunit 1

Synonyms

2610021O03Rik, tsg24, Apc1, Mcpr

MMRRC Submission

038667-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R0467 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

128610104-128687391 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 128669043 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 511 (I511T)

Ref Sequence

ENSEMBL: ENSMUSP00000105962 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000014499] [ENSMUST00000110333]

AlphaFold

P53995

Predicted Effect

probably damaging
Transcript: ENSMUST00000014499
AA Change: I511T

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000014499
Gene: ENSMUSG00000014355
AA Change: I511T

Domain	Start	End	E-Value	Type
Pfam:ANAPC1	150	214	1.7e-13	PFAM
low complexity region	323	345	N/A	INTRINSIC
low complexity region	1404	1415	N/A	INTRINSIC
Pfam:PC_rep	1467	1501	8.3e-8	PFAM
low complexity region	1516	1528	N/A	INTRINSIC
low complexity region	1924	1936	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000110333
AA Change: I511T

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000105962
Gene: ENSMUSG00000014355
AA Change: I511T

Domain	Start	End	E-Value	Type
Pfam:Apc1	149	227	1.7e-22	PFAM
low complexity region	323	345	N/A	INTRINSIC

Meta Mutation Damage Score

0.1992

Coding Region Coverage

1x: 99.6%
3x: 98.8%
10x: 96.7%
20x: 93.3%

Validation Efficiency

98% (52/53)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the anaphase-promoting complex. This complex is an E3 ubiquitin ligase that regulates progression through the metaphase to anaphase portion of the cell cycle by ubiquitinating proteins which targets them for degradation. [provided by RefSeq, Dec 2011]

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700022I11Rik	T	C	4: 42,972,715	S683P	probably benign	Het
2310007B03Rik	A	T	1: 93,153,044	I380N	probably damaging	Het
4931423N10Rik	A	G	2: 23,212,820	E190G	possibly damaging	Het
4933416C03Rik	G	A	10: 116,113,153	A156V	probably benign	Het
Abca17	A	G	17: 24,313,177		probably benign	Het
Atf6	A	T	1: 170,794,020	H477Q	probably damaging	Het
C4b	A	G	17: 34,736,127	V795A	probably benign	Het
Cdh26	C	T	2: 178,481,632	R675C	possibly damaging	Het
Cdk12	T	C	11: 98,203,579	V71A	probably damaging	Het
Cul3	A	T	1: 80,280,863	D419E	probably benign	Het
Ddi2	A	G	4: 141,685,184	I139T	probably benign	Het
Dnaaf1	T	A	8: 119,590,732	D333E	probably benign	Het
Dnase1	A	G	16: 4,039,149	D7G	probably damaging	Het
Fam71f1	G	A	6: 29,326,607	S241N	probably damaging	Het
G3bp1	T	C	11: 55,498,626	F383L	probably damaging	Het
Galc	A	C	12: 98,242,645	I250R	probably damaging	Het
Gcfc2	T	C	6: 81,923,882	V59A	possibly damaging	Het
Gm6133	A	C	18: 78,350,090	S100R	probably benign	Het
Iba57	T	C	11: 59,163,439	T85A	probably benign	Het
Ipo4	A	T	14: 55,635,526	M1K	probably null	Het
Ippk	A	G	13: 49,430,865		probably null	Het
Kcnk10	A	T	12: 98,489,945	I209N	probably benign	Het
Klk14	T	C	7: 43,694,110	L122P	probably benign	Het
Ltbp1	T	A	17: 75,282,429		probably null	Het
Mcm3	T	C	1: 20,804,847	D737G	probably benign	Het
Naip2	A	C	13: 100,161,782	I582S	probably benign	Het
Nalcn	T	A	14: 123,291,047	T1456S	probably benign	Het
Nckap1l	C	T	15: 103,497,427	P1097S	probably benign	Het
Ncoa1	A	G	12: 4,267,687	M1215T	possibly damaging	Het
Nomo1	T	A	7: 46,072,487		probably null	Het
Obox5	T	A	7: 15,758,007	C116S	possibly damaging	Het
Olfr644	C	T	7: 104,068,125	R302H	probably benign	Het
Olfr701	T	A	7: 106,818,361	S93T	possibly damaging	Het
Olfr76	C	A	19: 12,120,536	A59S	probably benign	Het
Pcdhb14	G	T	18: 37,449,224	R461L	probably damaging	Het
Pdgfra	A	G	5: 75,195,036	D1069G	probably damaging	Het
Pgr	C	T	9: 8,900,778	A104V	possibly damaging	Het
Pkd1l3	C	G	8: 109,623,649	D375E	possibly damaging	Het
Rassf3	A	G	10: 121,417,204		probably benign	Het
Rgs22	G	T	15: 36,099,795	S258*	probably null	Het
Rsph6a	C	A	7: 19,057,669	D254E	possibly damaging	Het
Sgk1	A	G	10: 21,996,358		probably benign	Het
Shcbp1l	G	A	1: 153,433,182	C174Y	probably damaging	Het
Sulf1	T	A	1: 12,796,920	N109K	probably damaging	Het
Tas2r115	T	A	6: 132,737,719	I90L	probably benign	Het
Tmem200a	T	C	10: 25,994,104	H89R	probably benign	Het
Ubxn4	G	A	1: 128,262,904	E256K	probably benign	Het
Xrn1	T	C	9: 96,024,191	S1212P	probably damaging	Het
Zfp408	T	C	2: 91,645,537	Y424C	possibly damaging	Het

Other mutations in Anapc1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00232:Anapc1	APN	2	128645130	splice site	probably benign
IGL00704:Anapc1	APN	2	128663984	missense	possibly damaging	0.48
IGL01023:Anapc1	APN	2	128629729	missense	probably damaging	1.00
IGL01432:Anapc1	APN	2	128633408	missense	probably damaging	1.00
IGL01549:Anapc1	APN	2	128653170	missense	probably benign
IGL02089:Anapc1	APN	2	128663933	missense	probably damaging	1.00
IGL02275:Anapc1	APN	2	128659852	missense	probably benign
IGL02570:Anapc1	APN	2	128645200	missense	probably damaging	1.00
IGL02597:Anapc1	APN	2	128623931	missense	probably benign	0.02
IGL02726:Anapc1	APN	2	128659785	missense	probably benign	0.05
IGL03265:Anapc1	APN	2	128627197	missense	probably damaging	1.00
IGL03304:Anapc1	APN	2	128627113	splice site	probably benign
IGL03327:Anapc1	APN	2	128623934	missense	probably benign	0.00
R0023:Anapc1	UTSW	2	128678218	missense	probably damaging	0.99
R0027:Anapc1	UTSW	2	128641511	missense	possibly damaging	0.96
R0027:Anapc1	UTSW	2	128641511	missense	possibly damaging	0.96
R0084:Anapc1	UTSW	2	128623966	splice site	probably benign
R0103:Anapc1	UTSW	2	128680452	splice site	probably benign
R0103:Anapc1	UTSW	2	128680452	splice site	probably benign
R0109:Anapc1	UTSW	2	128634693	missense	probably damaging	1.00
R0109:Anapc1	UTSW	2	128634693	missense	probably damaging	1.00
R0241:Anapc1	UTSW	2	128628629	missense	possibly damaging	0.89
R0241:Anapc1	UTSW	2	128628629	missense	possibly damaging	0.89
R0255:Anapc1	UTSW	2	128634711	missense	probably damaging	0.99
R0377:Anapc1	UTSW	2	128641340	critical splice donor site	probably null
R0514:Anapc1	UTSW	2	128632655	missense	probably damaging	0.99
R0591:Anapc1	UTSW	2	128619332	missense	probably benign	0.17
R0919:Anapc1	UTSW	2	128617731	missense	probably benign
R1175:Anapc1	UTSW	2	128680188	missense	probably damaging	1.00
R1473:Anapc1	UTSW	2	128617697	missense	possibly damaging	0.88
R1547:Anapc1	UTSW	2	128617556	missense	probably benign	0.44
R1556:Anapc1	UTSW	2	128624899	missense	probably benign	0.00
R1567:Anapc1	UTSW	2	128617716	missense	probably damaging	1.00
R1635:Anapc1	UTSW	2	128628532	missense	probably damaging	1.00
R1645:Anapc1	UTSW	2	128658246	critical splice donor site	probably null
R1677:Anapc1	UTSW	2	128676208	missense	probably benign	0.09
R1854:Anapc1	UTSW	2	128675890	missense	probably damaging	1.00
R1856:Anapc1	UTSW	2	128659788	missense	probably damaging	0.96
R1959:Anapc1	UTSW	2	128633415	missense	probably benign	0.36
R1984:Anapc1	UTSW	2	128669688	missense	possibly damaging	0.85
R2034:Anapc1	UTSW	2	128648458	missense	possibly damaging	0.92
R2283:Anapc1	UTSW	2	128642548	missense	probably benign	0.23
R2928:Anapc1	UTSW	2	128680137	missense	probably damaging	1.00
R3547:Anapc1	UTSW	2	128642682	missense	possibly damaging	0.58
R3904:Anapc1	UTSW	2	128642519	missense	probably damaging	1.00
R4156:Anapc1	UTSW	2	128627229	intron	probably benign
R4359:Anapc1	UTSW	2	128623556	missense	possibly damaging	0.64
R4392:Anapc1	UTSW	2	128676249	critical splice acceptor site	probably null
R4574:Anapc1	UTSW	2	128627195	missense	probably damaging	1.00
R4682:Anapc1	UTSW	2	128664005	missense	probably benign	0.05
R4770:Anapc1	UTSW	2	128686060	splice site	probably benign
R4824:Anapc1	UTSW	2	128628690	missense	possibly damaging	0.69
R4960:Anapc1	UTSW	2	128684594	missense	probably benign	0.23
R5016:Anapc1	UTSW	2	128607175	unclassified	probably benign
R5063:Anapc1	UTSW	2	128629549	missense	possibly damaging	0.48
R5128:Anapc1	UTSW	2	128659917	missense	probably benign
R5271:Anapc1	UTSW	2	128685985	nonsense	probably null
R5363:Anapc1	UTSW	2	128650194	critical splice donor site	probably null
R5469:Anapc1	UTSW	2	128675701	nonsense	probably null
R5473:Anapc1	UTSW	2	128607195	unclassified	probably benign
R5559:Anapc1	UTSW	2	128680434	nonsense	probably null
R5631:Anapc1	UTSW	2	128657217	missense	possibly damaging	0.85
R5747:Anapc1	UTSW	2	128624916	missense	probably benign	0.19
R5840:Anapc1	UTSW	2	128607037	unclassified	probably benign
R6226:Anapc1	UTSW	2	128650372	missense	probably damaging	1.00
R6526:Anapc1	UTSW	2	128672135	nonsense	probably null
R6561:Anapc1	UTSW	2	128663999	missense	probably damaging	0.98
R6743:Anapc1	UTSW	2	128684534	nonsense	probably null
R6799:Anapc1	UTSW	2	128659737	missense	probably null	0.38
R6887:Anapc1	UTSW	2	128659768	missense	possibly damaging	0.91
R6978:Anapc1	UTSW	2	128669900	missense	probably benign	0.06
R7011:Anapc1	UTSW	2	128648681	splice site	probably null
R7041:Anapc1	UTSW	2	128628656	missense	possibly damaging	0.88
R7047:Anapc1	UTSW	2	128615430	missense	probably damaging	0.96
R7074:Anapc1	UTSW	2	128678274	missense	probably damaging	1.00
R7109:Anapc1	UTSW	2	128674602	missense	probably benign	0.33
R7123:Anapc1	UTSW	2	128613010	missense	probably damaging	1.00
R7309:Anapc1	UTSW	2	128674684	missense	probably damaging	0.96
R7693:Anapc1	UTSW	2	128641537	missense	possibly damaging	0.86
R7839:Anapc1	UTSW	2	128684608	missense	probably damaging	0.99
R7847:Anapc1	UTSW	2	128669908	missense	possibly damaging	0.93
R7960:Anapc1	UTSW	2	128674593	missense	probably damaging	1.00
R8061:Anapc1	UTSW	2	128648488	missense	probably damaging	0.98
R8127:Anapc1	UTSW	2	128632627	missense	probably damaging	0.96
R8228:Anapc1	UTSW	2	128619917	nonsense	probably null
R8402:Anapc1	UTSW	2	128630228	missense	probably benign	0.02
R8422:Anapc1	UTSW	2	128675837	missense	probably benign
R8425:Anapc1	UTSW	2	128669868	missense	probably damaging	1.00
R8469:Anapc1	UTSW	2	128658344	splice site	probably null
R8553:Anapc1	UTSW	2	128619913	missense	possibly damaging	0.80
R8688:Anapc1	UTSW	2	128685828	missense	probably benign	0.19
R8699:Anapc1	UTSW	2	128641453	missense	probably damaging	1.00
R8719:Anapc1	UTSW	2	128641449	missense	probably damaging	1.00
R8775:Anapc1	UTSW	2	128657173	missense	possibly damaging	0.92
R8775-TAIL:Anapc1	UTSW	2	128657173	missense	possibly damaging	0.92
R8806:Anapc1	UTSW	2	128622413	missense	possibly damaging	0.67
R8973:Anapc1	UTSW	2	128664032	missense	probably damaging	0.99
R8977:Anapc1	UTSW	2	128641402	missense	probably damaging	1.00
R9000:Anapc1	UTSW	2	128634708	missense	probably damaging	1.00
R9080:Anapc1	UTSW	2	128622506	missense	possibly damaging	0.82
R9203:Anapc1	UTSW	2	128623502	missense	possibly damaging	0.66
R9314:Anapc1	UTSW	2	128622500	missense	possibly damaging	0.69
R9386:Anapc1	UTSW	2	128617722	missense	probably benign	0.08
R9415:Anapc1	UTSW	2	128634678	missense	probably benign
R9436:Anapc1	UTSW	2	128676125	missense	probably benign
R9516:Anapc1	UTSW	2	128675713	missense	possibly damaging	0.77
R9563:Anapc1	UTSW	2	128664060	nonsense	probably null
R9572:Anapc1	UTSW	2	128664056	missense	probably benign
R9757:Anapc1	UTSW	2	128675756	missense	probably damaging	1.00
R9766:Anapc1	UTSW	2	128658301	missense	probably damaging	1.00
X0066:Anapc1	UTSW	2	128674701	missense	probably benign	0.10

Predicted Primers

PCR Primer
(F):5'- CTCTCACAGCACAAAGGAGGTCAG -3'
(R):5'- AGGCAGGGTCTCACCTAGTAGTACAG -3'

Sequencing Primer
(F):5'- GCAGAATCTCCCACCTGTG -3'
(R):5'- cctctccactctctctccac -3'

Posted On

2013-05-23