Incidental Mutation 'R0467:Fam71f1'
ID41685
Institutional Source Beutler Lab
Gene Symbol Fam71f1
Ensembl Gene ENSMUSG00000039742
Gene Namefamily with sequence similarity 71, member F1
SynonymsLOC330277
MMRRC Submission 038667-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R0467 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location29319140-29336019 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 29326607 bp
ZygosityHeterozygous
Amino Acid Change Serine to Asparagine at position 241 (S241N)
Ref Sequence ENSEMBL: ENSMUSP00000132703 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090487] [ENSMUST00000163229] [ENSMUST00000164560] [ENSMUST00000166462]
Predicted Effect probably damaging
Transcript: ENSMUST00000090487
AA Change: S241N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000087973
Gene: ENSMUSG00000039742
AA Change: S241N

DomainStartEndE-ValueType
low complexity region 49 59 N/A INTRINSIC
Pfam:DUF3699 136 210 5e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163229
SMART Domains Protein: ENSMUSP00000132402
Gene: ENSMUSG00000039742

DomainStartEndE-ValueType
low complexity region 49 59 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000164560
AA Change: S241N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000126496
Gene: ENSMUSG00000039742
AA Change: S241N

DomainStartEndE-ValueType
low complexity region 49 59 N/A INTRINSIC
Pfam:DUF3699 137 208 7e-28 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000166462
AA Change: S241N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000132703
Gene: ENSMUSG00000039742
AA Change: S241N

DomainStartEndE-ValueType
low complexity region 49 59 N/A INTRINSIC
Pfam:DUF3699 136 210 3.1e-29 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168771
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171782
Meta Mutation Damage Score 0.0752 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 96.7%
  • 20x: 93.3%
Validation Efficiency 98% (52/53)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik T C 4: 42,972,715 S683P probably benign Het
2310007B03Rik A T 1: 93,153,044 I380N probably damaging Het
4931423N10Rik A G 2: 23,212,820 E190G possibly damaging Het
4933416C03Rik G A 10: 116,113,153 A156V probably benign Het
Abca17 A G 17: 24,313,177 probably benign Het
Anapc1 A G 2: 128,669,043 I511T probably damaging Het
Atf6 A T 1: 170,794,020 H477Q probably damaging Het
C4b A G 17: 34,736,127 V795A probably benign Het
Cdh26 C T 2: 178,481,632 R675C possibly damaging Het
Cdk12 T C 11: 98,203,579 V71A probably damaging Het
Cul3 A T 1: 80,280,863 D419E probably benign Het
Ddi2 A G 4: 141,685,184 I139T probably benign Het
Dnaaf1 T A 8: 119,590,732 D333E probably benign Het
Dnase1 A G 16: 4,039,149 D7G probably damaging Het
G3bp1 T C 11: 55,498,626 F383L probably damaging Het
Galc A C 12: 98,242,645 I250R probably damaging Het
Gcfc2 T C 6: 81,923,882 V59A possibly damaging Het
Gm6133 A C 18: 78,350,090 S100R probably benign Het
Iba57 T C 11: 59,163,439 T85A probably benign Het
Ipo4 A T 14: 55,635,526 M1K probably null Het
Ippk A G 13: 49,430,865 probably null Het
Kcnk10 A T 12: 98,489,945 I209N probably benign Het
Klk14 T C 7: 43,694,110 L122P probably benign Het
Ltbp1 T A 17: 75,282,429 probably null Het
Mcm3 T C 1: 20,804,847 D737G probably benign Het
Naip2 A C 13: 100,161,782 I582S probably benign Het
Nalcn T A 14: 123,291,047 T1456S probably benign Het
Nckap1l C T 15: 103,497,427 P1097S probably benign Het
Ncoa1 A G 12: 4,267,687 M1215T possibly damaging Het
Nomo1 T A 7: 46,072,487 probably null Het
Obox5 T A 7: 15,758,007 C116S possibly damaging Het
Olfr644 C T 7: 104,068,125 R302H probably benign Het
Olfr701 T A 7: 106,818,361 S93T possibly damaging Het
Olfr76 C A 19: 12,120,536 A59S probably benign Het
Pcdhb14 G T 18: 37,449,224 R461L probably damaging Het
Pdgfra A G 5: 75,195,036 D1069G probably damaging Het
Pgr C T 9: 8,900,778 A104V possibly damaging Het
Pkd1l3 C G 8: 109,623,649 D375E possibly damaging Het
Rassf3 A G 10: 121,417,204 probably benign Het
Rgs22 G T 15: 36,099,795 S258* probably null Het
Rsph6a C A 7: 19,057,669 D254E possibly damaging Het
Sgk1 A G 10: 21,996,358 probably benign Het
Shcbp1l G A 1: 153,433,182 C174Y probably damaging Het
Sulf1 T A 1: 12,796,920 N109K probably damaging Het
Tas2r115 T A 6: 132,737,719 I90L probably benign Het
Tmem200a T C 10: 25,994,104 H89R probably benign Het
Ubxn4 G A 1: 128,262,904 E256K probably benign Het
Xrn1 T C 9: 96,024,191 S1212P probably damaging Het
Zfp408 T C 2: 91,645,537 Y424C possibly damaging Het
Other mutations in Fam71f1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01434:Fam71f1 APN 6 29320701 missense probably damaging 0.99
IGL02342:Fam71f1 APN 6 29323830 missense possibly damaging 0.87
R0402:Fam71f1 UTSW 6 29323902 missense probably benign 0.01
R0610:Fam71f1 UTSW 6 29326577 missense probably benign 0.01
R1773:Fam71f1 UTSW 6 29334153 missense possibly damaging 0.83
R1950:Fam71f1 UTSW 6 29335816 utr 3 prime probably null
R4259:Fam71f1 UTSW 6 29320801 missense probably damaging 1.00
R4305:Fam71f1 UTSW 6 29326612 missense probably damaging 1.00
R4351:Fam71f1 UTSW 6 29320801 missense probably damaging 1.00
R4508:Fam71f1 UTSW 6 29323765 missense probably benign 0.04
R5014:Fam71f1 UTSW 6 29326724 intron probably benign
R5249:Fam71f1 UTSW 6 29323897 missense probably damaging 1.00
R5506:Fam71f1 UTSW 6 29319298 missense probably damaging 1.00
R6212:Fam71f1 UTSW 6 29319374 missense probably damaging 1.00
R6456:Fam71f1 UTSW 6 29334046 missense probably benign
R6949:Fam71f1 UTSW 6 29323906 missense probably damaging 1.00
R7047:Fam71f1 UTSW 6 29323810 missense probably damaging 1.00
R7562:Fam71f1 UTSW 6 29323834 missense probably damaging 1.00
X0065:Fam71f1 UTSW 6 29326661 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATTGGCAAGTATGCAATGAGGGC -3'
(R):5'- GCAATGACACCAGGTACTGTGTGAC -3'

Sequencing Primer
(F):5'- GAAAACTGCTTCCTTGAGAGAC -3'
(R):5'- ACTGTGTGACAGTATATCACATCCC -3'
Posted On2013-05-23