Incidental Mutation 'R0467:Gcfc2'
ID41686
Institutional Source Beutler Lab
Gene Symbol Gcfc2
Ensembl Gene ENSMUSG00000035125
Gene NameGC-rich sequence DNA binding factor 2
SynonymsAW146020
MMRRC Submission 038667-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.491) question?
Stock #R0467 (G1)
Quality Score108
Status Validated
Chromosome6
Chromosomal Location81923669-81959915 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 81923882 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 59 (V59A)
Ref Sequence ENSEMBL: ENSMUSP00000138136 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043195] [ENSMUST00000152996]
Predicted Effect probably benign
Transcript: ENSMUST00000043195
AA Change: V59A

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000035644
Gene: ENSMUSG00000035125
AA Change: V59A

DomainStartEndE-ValueType
low complexity region 16 24 N/A INTRINSIC
low complexity region 43 66 N/A INTRINSIC
low complexity region 97 111 N/A INTRINSIC
low complexity region 164 175 N/A INTRINSIC
low complexity region 193 210 N/A INTRINSIC
coiled coil region 255 308 N/A INTRINSIC
low complexity region 392 406 N/A INTRINSIC
Pfam:GCFC 456 672 3e-34 PFAM
low complexity region 753 763 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132301
Predicted Effect possibly damaging
Transcript: ENSMUST00000152996
AA Change: V59A

PolyPhen 2 Score 0.557 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000138136
Gene: ENSMUSG00000035125
AA Change: V59A

DomainStartEndE-ValueType
low complexity region 16 24 N/A INTRINSIC
low complexity region 43 66 N/A INTRINSIC
low complexity region 97 111 N/A INTRINSIC
low complexity region 164 175 N/A INTRINSIC
low complexity region 193 210 N/A INTRINSIC
Meta Mutation Damage Score 0.0699 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 96.7%
  • 20x: 93.3%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The first mRNA transcript isolated for this gene was part of an artificial chimera derived from two distinct gene transcripts and a primer used in the cloning process (see Genbank accession M29204). A positively charged amino terminus present only in the chimera was determined to bind GC-rich DNA, thus mistakenly thought to identify a transcription factor gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik T C 4: 42,972,715 S683P probably benign Het
2310007B03Rik A T 1: 93,153,044 I380N probably damaging Het
4931423N10Rik A G 2: 23,212,820 E190G possibly damaging Het
4933416C03Rik G A 10: 116,113,153 A156V probably benign Het
Abca17 A G 17: 24,313,177 probably benign Het
Anapc1 A G 2: 128,669,043 I511T probably damaging Het
Atf6 A T 1: 170,794,020 H477Q probably damaging Het
C4b A G 17: 34,736,127 V795A probably benign Het
Cdh26 C T 2: 178,481,632 R675C possibly damaging Het
Cdk12 T C 11: 98,203,579 V71A probably damaging Het
Cul3 A T 1: 80,280,863 D419E probably benign Het
Ddi2 A G 4: 141,685,184 I139T probably benign Het
Dnaaf1 T A 8: 119,590,732 D333E probably benign Het
Dnase1 A G 16: 4,039,149 D7G probably damaging Het
Fam71f1 G A 6: 29,326,607 S241N probably damaging Het
G3bp1 T C 11: 55,498,626 F383L probably damaging Het
Galc A C 12: 98,242,645 I250R probably damaging Het
Gm6133 A C 18: 78,350,090 S100R probably benign Het
Iba57 T C 11: 59,163,439 T85A probably benign Het
Ipo4 A T 14: 55,635,526 M1K probably null Het
Ippk A G 13: 49,430,865 probably null Het
Kcnk10 A T 12: 98,489,945 I209N probably benign Het
Klk14 T C 7: 43,694,110 L122P probably benign Het
Ltbp1 T A 17: 75,282,429 probably null Het
Mcm3 T C 1: 20,804,847 D737G probably benign Het
Naip2 A C 13: 100,161,782 I582S probably benign Het
Nalcn T A 14: 123,291,047 T1456S probably benign Het
Nckap1l C T 15: 103,497,427 P1097S probably benign Het
Ncoa1 A G 12: 4,267,687 M1215T possibly damaging Het
Nomo1 T A 7: 46,072,487 probably null Het
Obox5 T A 7: 15,758,007 C116S possibly damaging Het
Olfr644 C T 7: 104,068,125 R302H probably benign Het
Olfr701 T A 7: 106,818,361 S93T possibly damaging Het
Olfr76 C A 19: 12,120,536 A59S probably benign Het
Pcdhb14 G T 18: 37,449,224 R461L probably damaging Het
Pdgfra A G 5: 75,195,036 D1069G probably damaging Het
Pgr C T 9: 8,900,778 A104V possibly damaging Het
Pkd1l3 C G 8: 109,623,649 D375E possibly damaging Het
Rassf3 A G 10: 121,417,204 probably benign Het
Rgs22 G T 15: 36,099,795 S258* probably null Het
Rsph6a C A 7: 19,057,669 D254E possibly damaging Het
Sgk1 A G 10: 21,996,358 probably benign Het
Shcbp1l G A 1: 153,433,182 C174Y probably damaging Het
Sulf1 T A 1: 12,796,920 N109K probably damaging Het
Tas2r115 T A 6: 132,737,719 I90L probably benign Het
Tmem200a T C 10: 25,994,104 H89R probably benign Het
Ubxn4 G A 1: 128,262,904 E256K probably benign Het
Xrn1 T C 9: 96,024,191 S1212P probably damaging Het
Zfp408 T C 2: 91,645,537 Y424C possibly damaging Het
Other mutations in Gcfc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Gcfc2 APN 6 81936015 missense probably damaging 0.99
IGL00473:Gcfc2 APN 6 81944374 missense probably damaging 1.00
IGL00497:Gcfc2 APN 6 81957970 missense probably benign 0.08
IGL02135:Gcfc2 APN 6 81941400 missense probably damaging 1.00
R0138:Gcfc2 UTSW 6 81949954 missense probably damaging 1.00
R0208:Gcfc2 UTSW 6 81943463 missense probably null 0.91
R1105:Gcfc2 UTSW 6 81939453 missense probably damaging 1.00
R1521:Gcfc2 UTSW 6 81923812 missense probably benign 0.14
R1602:Gcfc2 UTSW 6 81944420 missense probably damaging 1.00
R1846:Gcfc2 UTSW 6 81956892 missense probably damaging 0.99
R2091:Gcfc2 UTSW 6 81943479 missense probably damaging 1.00
R2110:Gcfc2 UTSW 6 81923778 missense probably benign 0.01
R2111:Gcfc2 UTSW 6 81923778 missense probably benign 0.01
R2112:Gcfc2 UTSW 6 81923778 missense probably benign 0.01
R2892:Gcfc2 UTSW 6 81956913 missense possibly damaging 0.87
R3792:Gcfc2 UTSW 6 81930767 missense probably benign 0.00
R4284:Gcfc2 UTSW 6 81941391 missense probably damaging 1.00
R4304:Gcfc2 UTSW 6 81943007 missense probably damaging 1.00
R4691:Gcfc2 UTSW 6 81941427 nonsense probably null
R5046:Gcfc2 UTSW 6 81948335 missense probably benign 0.12
R5233:Gcfc2 UTSW 6 81953290 missense probably damaging 1.00
R5307:Gcfc2 UTSW 6 81944386 missense probably damaging 0.97
R5308:Gcfc2 UTSW 6 81943543 critical splice donor site probably null
R5929:Gcfc2 UTSW 6 81946599 missense probably damaging 1.00
R6339:Gcfc2 UTSW 6 81946496 missense probably damaging 1.00
R6485:Gcfc2 UTSW 6 81939547 missense probably damaging 1.00
R6931:Gcfc2 UTSW 6 81942985 missense probably benign 0.36
R6948:Gcfc2 UTSW 6 81933753 missense probably benign 0.01
R7392:Gcfc2 UTSW 6 81943012 critical splice donor site probably null
R7423:Gcfc2 UTSW 6 81946560 missense probably damaging 1.00
R7509:Gcfc2 UTSW 6 81953275 missense probably damaging 1.00
R7713:Gcfc2 UTSW 6 81941390 missense probably damaging 1.00
R8089:Gcfc2 UTSW 6 81925790 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACGCGCCAATCCTACTTGGAAC -3'
(R):5'- TGCACACCAATGGCTGTATGCTC -3'

Sequencing Primer
(F):5'- ACTTGGAACATGGCTCTCAG -3'
(R):5'- TCACCTGAGGATGCAAACTG -3'
Posted On2013-05-23