Incidental Mutation 'R0467:Olfr644'
ID41694
Institutional Source Beutler Lab
Gene Symbol Olfr644
Ensembl Gene ENSMUSG00000110012
Gene Nameolfactory receptor 644
SynonymsGA_x6K02T2PBJ9-6803062-6802118, MOR13-1
MMRRC Submission 038667-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.195) question?
Stock #R0467 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location104066289-104071869 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 104068125 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 302 (R302H)
Ref Sequence ENSEMBL: ENSMUSP00000149600 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077417] [ENSMUST00000138055] [ENSMUST00000213184] [ENSMUST00000213991]
Predicted Effect probably benign
Transcript: ENSMUST00000077417
AA Change: R302H

PolyPhen 2 Score 0.066 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000076633
Gene: ENSMUSG00000110012
AA Change: R302H

DomainStartEndE-ValueType
Pfam:7tm_4 33 312 2e-122 PFAM
Pfam:7TM_GPCR_Srsx 37 256 5.9e-8 PFAM
Pfam:7tm_1 43 294 1.4e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138055
SMART Domains Protein: ENSMUSP00000139240
Gene: ENSMUSG00000109824

DomainStartEndE-ValueType
transmembrane domain 29 51 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000213184
AA Change: R302H

PolyPhen 2 Score 0.066 (Sensitivity: 0.94; Specificity: 0.84)
Predicted Effect probably benign
Transcript: ENSMUST00000213991
AA Change: R302H

PolyPhen 2 Score 0.066 (Sensitivity: 0.94; Specificity: 0.84)
Meta Mutation Damage Score 0.1343 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 96.7%
  • 20x: 93.3%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik T C 4: 42,972,715 S683P probably benign Het
2310007B03Rik A T 1: 93,153,044 I380N probably damaging Het
4931423N10Rik A G 2: 23,212,820 E190G possibly damaging Het
4933416C03Rik G A 10: 116,113,153 A156V probably benign Het
Abca17 A G 17: 24,313,177 probably benign Het
Anapc1 A G 2: 128,669,043 I511T probably damaging Het
Atf6 A T 1: 170,794,020 H477Q probably damaging Het
C4b A G 17: 34,736,127 V795A probably benign Het
Cdh26 C T 2: 178,481,632 R675C possibly damaging Het
Cdk12 T C 11: 98,203,579 V71A probably damaging Het
Cul3 A T 1: 80,280,863 D419E probably benign Het
Ddi2 A G 4: 141,685,184 I139T probably benign Het
Dnaaf1 T A 8: 119,590,732 D333E probably benign Het
Dnase1 A G 16: 4,039,149 D7G probably damaging Het
Fam71f1 G A 6: 29,326,607 S241N probably damaging Het
G3bp1 T C 11: 55,498,626 F383L probably damaging Het
Galc A C 12: 98,242,645 I250R probably damaging Het
Gcfc2 T C 6: 81,923,882 V59A possibly damaging Het
Gm6133 A C 18: 78,350,090 S100R probably benign Het
Iba57 T C 11: 59,163,439 T85A probably benign Het
Ipo4 A T 14: 55,635,526 M1K probably null Het
Ippk A G 13: 49,430,865 probably null Het
Kcnk10 A T 12: 98,489,945 I209N probably benign Het
Klk14 T C 7: 43,694,110 L122P probably benign Het
Ltbp1 T A 17: 75,282,429 probably null Het
Mcm3 T C 1: 20,804,847 D737G probably benign Het
Naip2 A C 13: 100,161,782 I582S probably benign Het
Nalcn T A 14: 123,291,047 T1456S probably benign Het
Nckap1l C T 15: 103,497,427 P1097S probably benign Het
Ncoa1 A G 12: 4,267,687 M1215T possibly damaging Het
Nomo1 T A 7: 46,072,487 probably null Het
Obox5 T A 7: 15,758,007 C116S possibly damaging Het
Olfr701 T A 7: 106,818,361 S93T possibly damaging Het
Olfr76 C A 19: 12,120,536 A59S probably benign Het
Pcdhb14 G T 18: 37,449,224 R461L probably damaging Het
Pdgfra A G 5: 75,195,036 D1069G probably damaging Het
Pgr C T 9: 8,900,778 A104V possibly damaging Het
Pkd1l3 C G 8: 109,623,649 D375E possibly damaging Het
Rassf3 A G 10: 121,417,204 probably benign Het
Rgs22 G T 15: 36,099,795 S258* probably null Het
Rsph6a C A 7: 19,057,669 D254E possibly damaging Het
Sgk1 A G 10: 21,996,358 probably benign Het
Shcbp1l G A 1: 153,433,182 C174Y probably damaging Het
Sulf1 T A 1: 12,796,920 N109K probably damaging Het
Tas2r115 T A 6: 132,737,719 I90L probably benign Het
Tmem200a T C 10: 25,994,104 H89R probably benign Het
Ubxn4 G A 1: 128,262,904 E256K probably benign Het
Xrn1 T C 9: 96,024,191 S1212P probably damaging Het
Zfp408 T C 2: 91,645,537 Y424C possibly damaging Het
Other mutations in Olfr644
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01614:Olfr644 APN 7 104068369 missense probably benign 0.00
IGL02937:Olfr644 APN 7 104068849 missense probably damaging 0.99
IGL03188:Olfr644 APN 7 104068738 missense possibly damaging 0.89
FR4737:Olfr644 UTSW 7 104071292 start gained probably benign
R1310:Olfr644 UTSW 7 104068598 missense probably benign
R1457:Olfr644 UTSW 7 104068459 missense probably damaging 1.00
R1619:Olfr644 UTSW 7 104068531 missense probably damaging 1.00
R1874:Olfr644 UTSW 7 104068129 missense probably null 1.00
R2428:Olfr644 UTSW 7 104068468 nonsense probably null
R2922:Olfr644 UTSW 7 104068587 missense probably benign 0.09
R2923:Olfr644 UTSW 7 104068587 missense probably benign 0.09
R3929:Olfr644 UTSW 7 104068584 missense probably benign 0.06
R4500:Olfr644 UTSW 7 104068195 missense probably damaging 1.00
R5035:Olfr644 UTSW 7 104068407 missense possibly damaging 0.95
R5303:Olfr644 UTSW 7 104069032 utr 5 prime probably benign
R5464:Olfr644 UTSW 7 104068467 missense possibly damaging 0.72
R5722:Olfr644 UTSW 7 104068723 missense probably damaging 1.00
R5742:Olfr644 UTSW 7 104068205 missense probably damaging 0.97
R6874:Olfr644 UTSW 7 104068189 missense possibly damaging 0.50
R6940:Olfr644 UTSW 7 104068413 missense possibly damaging 0.82
R7848:Olfr644 UTSW 7 104068095 missense probably benign
R7931:Olfr644 UTSW 7 104068095 missense probably benign
Predicted Primers PCR Primer
(F):5'- GGAATCACAGTGCTAAGGTCAAAGATCA -3'
(R):5'- CTTTGGGCTGGATTCTGCACTCAT -3'

Sequencing Primer
(F):5'- GTGCTAAGGTCAAAGATCAAAATAAG -3'
(R):5'- GCTCAGTGCTTGCTATTGC -3'
Posted On2013-05-23