Incidental Mutation 'R0467:Olfr701'
ID41695
Institutional Source Beutler Lab
Gene Symbol Olfr701
Ensembl Gene ENSMUSG00000036744
Gene Nameolfactory receptor 701
Synonyms4933433E02Rik, MOR283-1, GA_x6K02T2PBJ9-9195805-9196755, 4932441H21Rik
MMRRC Submission 038667-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.168) question?
Stock #R0467 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location106814129-106821472 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 106818361 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 93 (S93T)
Ref Sequence ENSEMBL: ENSMUSP00000151783 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075414] [ENSMUST00000166880] [ENSMUST00000217739]
Predicted Effect possibly damaging
Transcript: ENSMUST00000075414
AA Change: S93T

PolyPhen 2 Score 0.494 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000074868
Gene: ENSMUSG00000036744
AA Change: S93T

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 2.9e-46 PFAM
Pfam:7tm_1 41 290 2.3e-24 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000166880
AA Change: S93T

PolyPhen 2 Score 0.494 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000130958
Gene: ENSMUSG00000036744
AA Change: S93T

DomainStartEndE-ValueType
Pfam:7tm_1 41 290 5.8e-31 PFAM
Pfam:7tm_4 139 283 1.8e-44 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209339
Predicted Effect possibly damaging
Transcript: ENSMUST00000217739
AA Change: S93T

PolyPhen 2 Score 0.494 (Sensitivity: 0.88; Specificity: 0.90)
Meta Mutation Damage Score 0.2217 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 96.7%
  • 20x: 93.3%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik T C 4: 42,972,715 S683P probably benign Het
2310007B03Rik A T 1: 93,153,044 I380N probably damaging Het
4931423N10Rik A G 2: 23,212,820 E190G possibly damaging Het
4933416C03Rik G A 10: 116,113,153 A156V probably benign Het
Abca17 A G 17: 24,313,177 probably benign Het
Anapc1 A G 2: 128,669,043 I511T probably damaging Het
Atf6 A T 1: 170,794,020 H477Q probably damaging Het
C4b A G 17: 34,736,127 V795A probably benign Het
Cdh26 C T 2: 178,481,632 R675C possibly damaging Het
Cdk12 T C 11: 98,203,579 V71A probably damaging Het
Cul3 A T 1: 80,280,863 D419E probably benign Het
Ddi2 A G 4: 141,685,184 I139T probably benign Het
Dnaaf1 T A 8: 119,590,732 D333E probably benign Het
Dnase1 A G 16: 4,039,149 D7G probably damaging Het
Fam71f1 G A 6: 29,326,607 S241N probably damaging Het
G3bp1 T C 11: 55,498,626 F383L probably damaging Het
Galc A C 12: 98,242,645 I250R probably damaging Het
Gcfc2 T C 6: 81,923,882 V59A possibly damaging Het
Gm6133 A C 18: 78,350,090 S100R probably benign Het
Iba57 T C 11: 59,163,439 T85A probably benign Het
Ipo4 A T 14: 55,635,526 M1K probably null Het
Ippk A G 13: 49,430,865 probably null Het
Kcnk10 A T 12: 98,489,945 I209N probably benign Het
Klk14 T C 7: 43,694,110 L122P probably benign Het
Ltbp1 T A 17: 75,282,429 probably null Het
Mcm3 T C 1: 20,804,847 D737G probably benign Het
Naip2 A C 13: 100,161,782 I582S probably benign Het
Nalcn T A 14: 123,291,047 T1456S probably benign Het
Nckap1l C T 15: 103,497,427 P1097S probably benign Het
Ncoa1 A G 12: 4,267,687 M1215T possibly damaging Het
Nomo1 T A 7: 46,072,487 probably null Het
Obox5 T A 7: 15,758,007 C116S possibly damaging Het
Olfr644 C T 7: 104,068,125 R302H probably benign Het
Olfr76 C A 19: 12,120,536 A59S probably benign Het
Pcdhb14 G T 18: 37,449,224 R461L probably damaging Het
Pdgfra A G 5: 75,195,036 D1069G probably damaging Het
Pgr C T 9: 8,900,778 A104V possibly damaging Het
Pkd1l3 C G 8: 109,623,649 D375E possibly damaging Het
Rassf3 A G 10: 121,417,204 probably benign Het
Rgs22 G T 15: 36,099,795 S258* probably null Het
Rsph6a C A 7: 19,057,669 D254E possibly damaging Het
Sgk1 A G 10: 21,996,358 probably benign Het
Shcbp1l G A 1: 153,433,182 C174Y probably damaging Het
Sulf1 T A 1: 12,796,920 N109K probably damaging Het
Tas2r115 T A 6: 132,737,719 I90L probably benign Het
Tmem200a T C 10: 25,994,104 H89R probably benign Het
Ubxn4 G A 1: 128,262,904 E256K probably benign Het
Xrn1 T C 9: 96,024,191 S1212P probably damaging Het
Zfp408 T C 2: 91,645,537 Y424C possibly damaging Het
Other mutations in Olfr701
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01476:Olfr701 APN 7 106818620 missense probably damaging 1.00
IGL01972:Olfr701 APN 7 106818532 missense probably benign 0.01
IGL02541:Olfr701 APN 7 106818602 missense probably benign 0.34
R0276:Olfr701 UTSW 7 106818697 missense probably benign 0.00
R0345:Olfr701 UTSW 7 106818701 missense probably benign 0.38
R1829:Olfr701 UTSW 7 106819007 missense probably benign
R3116:Olfr701 UTSW 7 106818364 missense probably damaging 0.98
R3870:Olfr701 UTSW 7 106818840 nonsense probably null
R5267:Olfr701 UTSW 7 106818808 missense probably damaging 1.00
R6036:Olfr701 UTSW 7 106818460 missense probably damaging 1.00
R6036:Olfr701 UTSW 7 106818460 missense probably damaging 1.00
R7229:Olfr701 UTSW 7 106818995 missense probably damaging 0.97
R7230:Olfr701 UTSW 7 106818179 missense possibly damaging 0.78
R7231:Olfr701 UTSW 7 106818443 missense probably damaging 1.00
R7419:Olfr701 UTSW 7 106818344 missense possibly damaging 0.89
R7537:Olfr701 UTSW 7 106818374 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCTCTGTGCCACAGTTACAACC -3'
(R):5'- TGTGTCTGCACAAGCCAATTTCAAC -3'

Sequencing Primer
(F):5'- CAGTTACAACCCTGTACATGTTGG -3'
(R):5'- GGGCACTAAgagatgctagg -3'
Posted On2013-05-23