Incidental Mutation 'R0467:Pgr'
ID41697
Institutional Source Beutler Lab
Gene Symbol Pgr
Ensembl Gene ENSMUSG00000031870
Gene Nameprogesterone receptor
Synonyms9930019P03Rik, ENSMUSG00000074510, PR-A, PR-B, PR, NR3C3
MMRRC Submission 038667-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.442) question?
Stock #R0467 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location8899833-8968611 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 8900778 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 104 (A104V)
Ref Sequence ENSEMBL: ENSMUSP00000140124 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070463] [ENSMUST00000098986] [ENSMUST00000189181]
Predicted Effect possibly damaging
Transcript: ENSMUST00000070463
AA Change: A104V

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000063562
Gene: ENSMUSG00000031870
AA Change: A104V

DomainStartEndE-ValueType
low complexity region 45 55 N/A INTRINSIC
low complexity region 108 120 N/A INTRINSIC
low complexity region 244 265 N/A INTRINSIC
low complexity region 337 354 N/A INTRINSIC
low complexity region 418 431 N/A INTRINSIC
low complexity region 434 454 N/A INTRINSIC
low complexity region 493 503 N/A INTRINSIC
low complexity region 505 519 N/A INTRINSIC
ZnF_C4 557 628 1.29e-29 SMART
low complexity region 703 711 N/A INTRINSIC
HOLI 713 877 3.21e-34 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000098986
SMART Domains Protein: ENSMUSP00000096584
Gene: ENSMUSG00000031870

DomainStartEndE-ValueType
low complexity region 79 100 N/A INTRINSIC
low complexity region 172 189 N/A INTRINSIC
low complexity region 253 266 N/A INTRINSIC
low complexity region 269 289 N/A INTRINSIC
low complexity region 328 338 N/A INTRINSIC
low complexity region 340 354 N/A INTRINSIC
ZnF_C4 392 463 1.29e-29 SMART
low complexity region 538 546 N/A INTRINSIC
HOLI 548 712 3.21e-34 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151080
Predicted Effect possibly damaging
Transcript: ENSMUST00000189181
AA Change: A104V

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000140124
Gene: ENSMUSG00000031870
AA Change: A104V

DomainStartEndE-ValueType
low complexity region 45 55 N/A INTRINSIC
low complexity region 108 120 N/A INTRINSIC
low complexity region 244 265 N/A INTRINSIC
low complexity region 337 354 N/A INTRINSIC
low complexity region 418 431 N/A INTRINSIC
low complexity region 434 454 N/A INTRINSIC
low complexity region 493 503 N/A INTRINSIC
low complexity region 505 519 N/A INTRINSIC
ZnF_C4 557 628 1.29e-29 SMART
low complexity region 703 711 N/A INTRINSIC
HOLI 713 877 3.21e-34 SMART
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 96.7%
  • 20x: 93.3%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: This gene encodes a member of the steroid receptor superfamily. The encoded protein mediates the physiological effects of progesterone, which plays a central role in reproductive events associated with the establishment and maintenance of pregnancy. [provided by RefSeq, Sep 2015]
PHENOTYPE: Null female mice are sterile and exhibit ovulatory defects, uterine hyperplasia, and impaired mammary development. Females lacking only isoform A are infertile but show normal mammary development, while females lacking only isoform B are fertile but present with mammary developmental defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik T C 4: 42,972,715 S683P probably benign Het
2310007B03Rik A T 1: 93,153,044 I380N probably damaging Het
4931423N10Rik A G 2: 23,212,820 E190G possibly damaging Het
4933416C03Rik G A 10: 116,113,153 A156V probably benign Het
Abca17 A G 17: 24,313,177 probably benign Het
Anapc1 A G 2: 128,669,043 I511T probably damaging Het
Atf6 A T 1: 170,794,020 H477Q probably damaging Het
C4b A G 17: 34,736,127 V795A probably benign Het
Cdh26 C T 2: 178,481,632 R675C possibly damaging Het
Cdk12 T C 11: 98,203,579 V71A probably damaging Het
Cul3 A T 1: 80,280,863 D419E probably benign Het
Ddi2 A G 4: 141,685,184 I139T probably benign Het
Dnaaf1 T A 8: 119,590,732 D333E probably benign Het
Dnase1 A G 16: 4,039,149 D7G probably damaging Het
Fam71f1 G A 6: 29,326,607 S241N probably damaging Het
G3bp1 T C 11: 55,498,626 F383L probably damaging Het
Galc A C 12: 98,242,645 I250R probably damaging Het
Gcfc2 T C 6: 81,923,882 V59A possibly damaging Het
Gm6133 A C 18: 78,350,090 S100R probably benign Het
Iba57 T C 11: 59,163,439 T85A probably benign Het
Ipo4 A T 14: 55,635,526 M1K probably null Het
Ippk A G 13: 49,430,865 probably null Het
Kcnk10 A T 12: 98,489,945 I209N probably benign Het
Klk14 T C 7: 43,694,110 L122P probably benign Het
Ltbp1 T A 17: 75,282,429 probably null Het
Mcm3 T C 1: 20,804,847 D737G probably benign Het
Naip2 A C 13: 100,161,782 I582S probably benign Het
Nalcn T A 14: 123,291,047 T1456S probably benign Het
Nckap1l C T 15: 103,497,427 P1097S probably benign Het
Ncoa1 A G 12: 4,267,687 M1215T possibly damaging Het
Nomo1 T A 7: 46,072,487 probably null Het
Obox5 T A 7: 15,758,007 C116S possibly damaging Het
Olfr644 C T 7: 104,068,125 R302H probably benign Het
Olfr701 T A 7: 106,818,361 S93T possibly damaging Het
Olfr76 C A 19: 12,120,536 A59S probably benign Het
Pcdhb14 G T 18: 37,449,224 R461L probably damaging Het
Pdgfra A G 5: 75,195,036 D1069G probably damaging Het
Pkd1l3 C G 8: 109,623,649 D375E possibly damaging Het
Rassf3 A G 10: 121,417,204 probably benign Het
Rgs22 G T 15: 36,099,795 S258* probably null Het
Rsph6a C A 7: 19,057,669 D254E possibly damaging Het
Sgk1 A G 10: 21,996,358 probably benign Het
Shcbp1l G A 1: 153,433,182 C174Y probably damaging Het
Sulf1 T A 1: 12,796,920 N109K probably damaging Het
Tas2r115 T A 6: 132,737,719 I90L probably benign Het
Tmem200a T C 10: 25,994,104 H89R probably benign Het
Ubxn4 G A 1: 128,262,904 E256K probably benign Het
Xrn1 T C 9: 96,024,191 S1212P probably damaging Het
Zfp408 T C 2: 91,645,537 Y424C possibly damaging Het
Other mutations in Pgr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01610:Pgr APN 9 8903691 missense possibly damaging 0.71
IGL01772:Pgr APN 9 8946636 splice site probably benign
IGL01963:Pgr APN 9 8922668 missense probably damaging 0.97
IGL02033:Pgr APN 9 8965110 missense probably damaging 1.00
IGL02837:Pgr APN 9 8946638 splice site probably benign
IGL03070:Pgr APN 9 8903664 missense possibly damaging 0.86
IGL03300:Pgr APN 9 8961539 missense probably damaging 1.00
R0152:Pgr UTSW 9 8965022 missense probably benign 0.45
R0305:Pgr UTSW 9 8902087 splice site probably benign
R0317:Pgr UTSW 9 8965022 missense probably benign 0.45
R1673:Pgr UTSW 9 8902068 missense possibly damaging 0.71
R1711:Pgr UTSW 9 8922714 splice site probably null
R1928:Pgr UTSW 9 8903629 nonsense probably null
R1951:Pgr UTSW 9 8946953 splice site probably benign
R2023:Pgr UTSW 9 8958398 missense probably damaging 0.99
R2426:Pgr UTSW 9 8900717 missense probably damaging 0.98
R2967:Pgr UTSW 9 8901818 missense possibly damaging 0.86
R3105:Pgr UTSW 9 8958396 missense probably benign 0.02
R3440:Pgr UTSW 9 8922629 missense probably damaging 0.98
R3735:Pgr UTSW 9 8901533 missense probably damaging 0.99
R3947:Pgr UTSW 9 8961452 missense probably benign 0.25
R4398:Pgr UTSW 9 8903749 critical splice donor site probably null
R4497:Pgr UTSW 9 8958419 missense probably damaging 0.99
R4811:Pgr UTSW 9 8900843 nonsense probably null
R4907:Pgr UTSW 9 8947043 intron probably benign
R4996:Pgr UTSW 9 8900913 missense probably damaging 0.99
R5448:Pgr UTSW 9 8922637 missense probably benign 0.06
R5449:Pgr UTSW 9 8956343 missense possibly damaging 0.95
R5699:Pgr UTSW 9 8900599 start gained probably benign
R5764:Pgr UTSW 9 8900537 missense probably benign 0.00
R6057:Pgr UTSW 9 8902005 missense probably damaging 0.98
R6134:Pgr UTSW 9 8900739 missense possibly damaging 0.51
R6242:Pgr UTSW 9 8900979 missense probably benign
R6476:Pgr UTSW 9 8964838 intron probably null
R6508:Pgr UTSW 9 8956289 missense probably damaging 1.00
R6604:Pgr UTSW 9 8946866 missense possibly damaging 0.73
R6715:Pgr UTSW 9 8964999 missense possibly damaging 0.93
R7444:Pgr UTSW 9 8946882 missense probably damaging 1.00
R7769:Pgr UTSW 9 8946855 missense possibly damaging 0.88
R7899:Pgr UTSW 9 8903742 missense probably benign 0.11
R7982:Pgr UTSW 9 8903742 missense probably benign 0.11
R8139:Pgr UTSW 9 8956340 missense possibly damaging 0.61
X0066:Pgr UTSW 9 8900834 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- AGACCAGCTTGCTCCAGCTACTTC -3'
(R):5'- CAACAACCCTTTGGTAGCAGGGAC -3'

Sequencing Primer
(F):5'- cccctcctccttcccttttc -3'
(R):5'- GTAGCAGGGACACTGCG -3'
Posted On2013-05-23