Incidental Mutation 'R0467:Xrn1'
ID41698
Institutional Source Beutler Lab
Gene Symbol Xrn1
Ensembl Gene ENSMUSG00000032410
Gene Name5'-3' exoribonuclease 1
SynonymsDhm2, mXrn1
MMRRC Submission 038667-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.929) question?
Stock #R0467 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location95954760-96057803 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 96024191 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 1212 (S1212P)
Ref Sequence ENSEMBL: ENSMUSP00000034981 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034981] [ENSMUST00000185633]
Predicted Effect probably damaging
Transcript: ENSMUST00000034981
AA Change: S1212P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000034981
Gene: ENSMUSG00000032410
AA Change: S1212P

DomainStartEndE-ValueType
Pfam:XRN_N 1 227 8.4e-99 PFAM
low complexity region 372 389 N/A INTRINSIC
low complexity region 414 430 N/A INTRINSIC
low complexity region 662 673 N/A INTRINSIC
low complexity region 1054 1066 N/A INTRINSIC
low complexity region 1555 1566 N/A INTRINSIC
low complexity region 1665 1684 N/A INTRINSIC
low complexity region 1696 1711 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000185633
AA Change: S1212P

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000140278
Gene: ENSMUSG00000032410
AA Change: S1212P

DomainStartEndE-ValueType
Pfam:XRN_N 1 228 1.2e-103 PFAM
low complexity region 372 389 N/A INTRINSIC
low complexity region 414 430 N/A INTRINSIC
low complexity region 662 673 N/A INTRINSIC
low complexity region 1054 1066 N/A INTRINSIC
low complexity region 1551 1562 N/A INTRINSIC
low complexity region 1661 1680 N/A INTRINSIC
low complexity region 1692 1707 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186632
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187175
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187359
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189281
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190970
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194610
Meta Mutation Damage Score 0.1413 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 96.7%
  • 20x: 93.3%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the 5'-3' exonuclease family. The encoded protein may be involved in replication-dependent histone mRNA degradation, and interacts directly with the enhancer of mRNA-decapping protein 4. In addition to mRNA metabolism, a similar protein in yeast has been implicated in a variety of nuclear and cytoplasmic functions, including homologous recombination, meiosis, telomere maintenance, and microtubule assembly. Mutations in this gene are associated with osteosarcoma, suggesting that the encoded protein may also play a role in bone formation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik T C 4: 42,972,715 S683P probably benign Het
2310007B03Rik A T 1: 93,153,044 I380N probably damaging Het
4931423N10Rik A G 2: 23,212,820 E190G possibly damaging Het
4933416C03Rik G A 10: 116,113,153 A156V probably benign Het
Abca17 A G 17: 24,313,177 probably benign Het
Anapc1 A G 2: 128,669,043 I511T probably damaging Het
Atf6 A T 1: 170,794,020 H477Q probably damaging Het
C4b A G 17: 34,736,127 V795A probably benign Het
Cdh26 C T 2: 178,481,632 R675C possibly damaging Het
Cdk12 T C 11: 98,203,579 V71A probably damaging Het
Cul3 A T 1: 80,280,863 D419E probably benign Het
Ddi2 A G 4: 141,685,184 I139T probably benign Het
Dnaaf1 T A 8: 119,590,732 D333E probably benign Het
Dnase1 A G 16: 4,039,149 D7G probably damaging Het
Fam71f1 G A 6: 29,326,607 S241N probably damaging Het
G3bp1 T C 11: 55,498,626 F383L probably damaging Het
Galc A C 12: 98,242,645 I250R probably damaging Het
Gcfc2 T C 6: 81,923,882 V59A possibly damaging Het
Gm6133 A C 18: 78,350,090 S100R probably benign Het
Iba57 T C 11: 59,163,439 T85A probably benign Het
Ipo4 A T 14: 55,635,526 M1K probably null Het
Ippk A G 13: 49,430,865 probably null Het
Kcnk10 A T 12: 98,489,945 I209N probably benign Het
Klk14 T C 7: 43,694,110 L122P probably benign Het
Ltbp1 T A 17: 75,282,429 probably null Het
Mcm3 T C 1: 20,804,847 D737G probably benign Het
Naip2 A C 13: 100,161,782 I582S probably benign Het
Nalcn T A 14: 123,291,047 T1456S probably benign Het
Nckap1l C T 15: 103,497,427 P1097S probably benign Het
Ncoa1 A G 12: 4,267,687 M1215T possibly damaging Het
Nomo1 T A 7: 46,072,487 probably null Het
Obox5 T A 7: 15,758,007 C116S possibly damaging Het
Olfr644 C T 7: 104,068,125 R302H probably benign Het
Olfr701 T A 7: 106,818,361 S93T possibly damaging Het
Olfr76 C A 19: 12,120,536 A59S probably benign Het
Pcdhb14 G T 18: 37,449,224 R461L probably damaging Het
Pdgfra A G 5: 75,195,036 D1069G probably damaging Het
Pgr C T 9: 8,900,778 A104V possibly damaging Het
Pkd1l3 C G 8: 109,623,649 D375E possibly damaging Het
Rassf3 A G 10: 121,417,204 probably benign Het
Rgs22 G T 15: 36,099,795 S258* probably null Het
Rsph6a C A 7: 19,057,669 D254E possibly damaging Het
Sgk1 A G 10: 21,996,358 probably benign Het
Shcbp1l G A 1: 153,433,182 C174Y probably damaging Het
Sulf1 T A 1: 12,796,920 N109K probably damaging Het
Tas2r115 T A 6: 132,737,719 I90L probably benign Het
Tmem200a T C 10: 25,994,104 H89R probably benign Het
Ubxn4 G A 1: 128,262,904 E256K probably benign Het
Zfp408 T C 2: 91,645,537 Y424C possibly damaging Het
Other mutations in Xrn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00487:Xrn1 APN 9 96038949 missense probably benign 0.05
IGL00778:Xrn1 APN 9 95973447 splice site probably benign
IGL01936:Xrn1 APN 9 96048344 missense probably damaging 0.98
IGL01983:Xrn1 APN 9 95973368 critical splice donor site probably null
IGL02106:Xrn1 APN 9 95977805 missense probably benign 0.28
IGL02330:Xrn1 APN 9 95973348 nonsense probably null
IGL02338:Xrn1 APN 9 95977827 missense probably benign 0.42
IGL02830:Xrn1 APN 9 96018181 critical splice donor site probably null
R0063:Xrn1 UTSW 9 95969535 missense probably damaging 1.00
R0063:Xrn1 UTSW 9 95969535 missense probably damaging 1.00
R0508:Xrn1 UTSW 9 96051736 missense probably benign 0.00
R0605:Xrn1 UTSW 9 96026877 nonsense probably null
R0670:Xrn1 UTSW 9 95991056 missense probably damaging 1.00
R0691:Xrn1 UTSW 9 95973539 missense probably damaging 0.96
R0781:Xrn1 UTSW 9 95991269 missense probably benign 0.00
R0947:Xrn1 UTSW 9 95998263 missense possibly damaging 0.60
R1034:Xrn1 UTSW 9 96039737 missense probably damaging 1.00
R1124:Xrn1 UTSW 9 96003865 missense probably benign 0.02
R1171:Xrn1 UTSW 9 95991011 missense possibly damaging 0.47
R1199:Xrn1 UTSW 9 95981761 splice site probably benign
R1609:Xrn1 UTSW 9 95974893 missense probably benign 0.03
R1921:Xrn1 UTSW 9 95999497 missense probably benign 0.04
R1953:Xrn1 UTSW 9 96024221 critical splice donor site probably null
R2000:Xrn1 UTSW 9 96045563 nonsense probably null
R2109:Xrn1 UTSW 9 95979220 missense probably benign 0.13
R2111:Xrn1 UTSW 9 96039832 missense probably benign 0.03
R2164:Xrn1 UTSW 9 96006820 missense possibly damaging 0.95
R2266:Xrn1 UTSW 9 96006712 missense possibly damaging 0.64
R3754:Xrn1 UTSW 9 95967788 missense probably damaging 1.00
R3783:Xrn1 UTSW 9 95969285 missense probably benign 0.10
R3921:Xrn1 UTSW 9 95969284 missense probably benign 0.01
R3929:Xrn1 UTSW 9 95988873 missense possibly damaging 0.89
R4011:Xrn1 UTSW 9 95985225 nonsense probably null
R4082:Xrn1 UTSW 9 95981920 missense probably benign 0.02
R4455:Xrn1 UTSW 9 95973645 intron probably benign
R4736:Xrn1 UTSW 9 96033636 missense probably damaging 1.00
R4756:Xrn1 UTSW 9 96039809 missense probably benign 0.00
R4780:Xrn1 UTSW 9 95974744 intron probably benign
R5152:Xrn1 UTSW 9 95964065 missense probably benign 0.40
R5261:Xrn1 UTSW 9 96045543 missense probably benign 0.00
R5741:Xrn1 UTSW 9 96045551 missense probably benign 0.24
R6108:Xrn1 UTSW 9 95974427 missense possibly damaging 0.91
R6127:Xrn1 UTSW 9 95969489 missense probably damaging 0.99
R6268:Xrn1 UTSW 9 95964014 missense probably damaging 1.00
R6418:Xrn1 UTSW 9 96033710 intron probably null
R7002:Xrn1 UTSW 9 96047790 missense probably benign 0.00
R7067:Xrn1 UTSW 9 95969512 missense probably damaging 0.98
R7155:Xrn1 UTSW 9 95979145 missense possibly damaging 0.92
R7439:Xrn1 UTSW 9 96051629 missense probably benign
R7447:Xrn1 UTSW 9 96045494 missense probably benign
R7454:Xrn1 UTSW 9 96048358 missense probably benign 0.03
R7473:Xrn1 UTSW 9 95979141 missense probably benign 0.07
R7561:Xrn1 UTSW 9 95999458 missense probably benign 0.18
R7580:Xrn1 UTSW 9 96011679 missense not run
R7642:Xrn1 UTSW 9 96021853 missense possibly damaging 0.95
R7763:Xrn1 UTSW 9 95998348 critical splice donor site probably null
Z1176:Xrn1 UTSW 9 95964190 missense probably damaging 1.00
Z1177:Xrn1 UTSW 9 95991005 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGCCCACATCATAGGAATGCACAAG -3'
(R):5'- AGGGACATGACATACATGGTCCAGG -3'

Sequencing Primer
(F):5'- AGTCCCTCCACTGAGATGATG -3'
(R):5'- GTCTCCACTTACAAGTTGTCAAGA -3'
Posted On2013-05-23