Incidental Mutation 'R0467:Sgk1'
ID41699
Institutional Source Beutler Lab
Gene Symbol Sgk1
Ensembl Gene ENSMUSG00000019970
Gene Nameserum/glucocorticoid regulated kinase 1
SynonymsSgk, Sgk1
MMRRC Submission 038667-MU
Accession Numbers

Ncbi RefSeq: NM_001161845.2, NM_001161847.2, NM_001161848.2, NM_001161849.2, NM_001161850.2, NM_011361.3; MGI:1340062

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0467 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location21882184-21999903 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 21996358 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000128873 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020145] [ENSMUST00000092673] [ENSMUST00000100036] [ENSMUST00000120509] [ENSMUST00000124350] [ENSMUST00000142174] [ENSMUST00000150089] [ENSMUST00000164659]
Predicted Effect probably benign
Transcript: ENSMUST00000020145
SMART Domains Protein: ENSMUSP00000020145
Gene: ENSMUSG00000019970

DomainStartEndE-ValueType
Blast:S_TKc 36 72 4e-10 BLAST
low complexity region 73 80 N/A INTRINSIC
S_TKc 98 355 6.15e-106 SMART
S_TK_X 356 425 2.51e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000092673
SMART Domains Protein: ENSMUSP00000090343
Gene: ENSMUSG00000019970

DomainStartEndE-ValueType
low complexity region 7 20 N/A INTRINSIC
Blast:S_TKc 50 86 5e-10 BLAST
low complexity region 87 94 N/A INTRINSIC
S_TKc 112 369 6.15e-106 SMART
S_TK_X 370 439 2.51e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000100036
SMART Domains Protein: ENSMUSP00000097614
Gene: ENSMUSG00000019970

DomainStartEndE-ValueType
Blast:S_TKc 22 58 5e-10 BLAST
low complexity region 59 66 N/A INTRINSIC
S_TKc 84 341 6.15e-106 SMART
S_TK_X 342 411 2.51e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000120509
SMART Domains Protein: ENSMUSP00000114074
Gene: ENSMUSG00000019970

DomainStartEndE-ValueType
Blast:S_TKc 129 165 1e-9 BLAST
low complexity region 166 173 N/A INTRINSIC
S_TKc 191 448 6.15e-106 SMART
S_TK_X 449 518 2.51e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000124350
SMART Domains Protein: ENSMUSP00000114691
Gene: ENSMUSG00000019970

DomainStartEndE-ValueType
Blast:S_TKc 9 45 2e-12 BLAST
low complexity region 46 53 N/A INTRINSIC
Pfam:Pkinase 71 266 3.2e-62 PFAM
Pfam:Pkinase_Tyr 71 266 4.4e-34 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126560
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135195
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141218
Predicted Effect probably benign
Transcript: ENSMUST00000142174
SMART Domains Protein: ENSMUSP00000120882
Gene: ENSMUSG00000019970

DomainStartEndE-ValueType
Blast:S_TKc 9 45 3e-14 BLAST
PDB:3HDN|A 33 82 7e-18 PDB
SCOP:d1koba_ 43 82 4e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000150089
SMART Domains Protein: ENSMUSP00000115073
Gene: ENSMUSG00000019970

DomainStartEndE-ValueType
Blast:S_TKc 22 58 4e-14 BLAST
PDB:3HDN|A 46 89 3e-13 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000164659
SMART Domains Protein: ENSMUSP00000128873
Gene: ENSMUSG00000019970

DomainStartEndE-ValueType
Blast:S_TKc 9 45 5e-10 BLAST
low complexity region 46 53 N/A INTRINSIC
S_TKc 71 328 6.15e-106 SMART
S_TK_X 329 398 2.51e-19 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 96.7%
  • 20x: 93.3%
Validation Efficiency 98% (52/53)
MGI Phenotype Strain: 3846797; 2445418
FUNCTION: This gene encodes a serine/threonine protein kinase that plays an important role in cellular stress response. This kinase activates certain potassium, sodium, and chloride channels, suggesting an involvement in the regulation of processes such as cell survival, neuronal excitability, and renal sodium excretion. This enzyme is activated by protein phosphorylation and degraded via the ubiquitination and proteasome pathway. Multiple transcript variants encoding different isoforms have been found for this gene. A pseudogene of this gene was identified on chromosome 12. [provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for a disruption in this gene display an essentially normal phenotype. Sodium retention is compromised on a low salt diet. [provided by MGI curators]
Allele List at MGI

All alleles(143) : Targeted(6) Gene trapped(137)

Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik T C 4: 42,972,715 S683P probably benign Het
2310007B03Rik A T 1: 93,153,044 I380N probably damaging Het
4931423N10Rik A G 2: 23,212,820 E190G possibly damaging Het
4933416C03Rik G A 10: 116,113,153 A156V probably benign Het
Abca17 A G 17: 24,313,177 probably benign Het
Anapc1 A G 2: 128,669,043 I511T probably damaging Het
Atf6 A T 1: 170,794,020 H477Q probably damaging Het
C4b A G 17: 34,736,127 V795A probably benign Het
Cdh26 C T 2: 178,481,632 R675C possibly damaging Het
Cdk12 T C 11: 98,203,579 V71A probably damaging Het
Cul3 A T 1: 80,280,863 D419E probably benign Het
Ddi2 A G 4: 141,685,184 I139T probably benign Het
Dnaaf1 T A 8: 119,590,732 D333E probably benign Het
Dnase1 A G 16: 4,039,149 D7G probably damaging Het
Fam71f1 G A 6: 29,326,607 S241N probably damaging Het
G3bp1 T C 11: 55,498,626 F383L probably damaging Het
Galc A C 12: 98,242,645 I250R probably damaging Het
Gcfc2 T C 6: 81,923,882 V59A possibly damaging Het
Gm6133 A C 18: 78,350,090 S100R probably benign Het
Iba57 T C 11: 59,163,439 T85A probably benign Het
Ipo4 A T 14: 55,635,526 M1K probably null Het
Ippk A G 13: 49,430,865 probably null Het
Kcnk10 A T 12: 98,489,945 I209N probably benign Het
Klk14 T C 7: 43,694,110 L122P probably benign Het
Ltbp1 T A 17: 75,282,429 probably null Het
Mcm3 T C 1: 20,804,847 D737G probably benign Het
Naip2 A C 13: 100,161,782 I582S probably benign Het
Nalcn T A 14: 123,291,047 T1456S probably benign Het
Nckap1l C T 15: 103,497,427 P1097S probably benign Het
Ncoa1 A G 12: 4,267,687 M1215T possibly damaging Het
Nomo1 T A 7: 46,072,487 probably null Het
Obox5 T A 7: 15,758,007 C116S possibly damaging Het
Olfr644 C T 7: 104,068,125 R302H probably benign Het
Olfr701 T A 7: 106,818,361 S93T possibly damaging Het
Olfr76 C A 19: 12,120,536 A59S probably benign Het
Pcdhb14 G T 18: 37,449,224 R461L probably damaging Het
Pdgfra A G 5: 75,195,036 D1069G probably damaging Het
Pgr C T 9: 8,900,778 A104V possibly damaging Het
Pkd1l3 C G 8: 109,623,649 D375E possibly damaging Het
Rassf3 A G 10: 121,417,204 probably benign Het
Rgs22 G T 15: 36,099,795 S258* probably null Het
Rsph6a C A 7: 19,057,669 D254E possibly damaging Het
Shcbp1l G A 1: 153,433,182 C174Y probably damaging Het
Sulf1 T A 1: 12,796,920 N109K probably damaging Het
Tas2r115 T A 6: 132,737,719 I90L probably benign Het
Tmem200a T C 10: 25,994,104 H89R probably benign Het
Ubxn4 G A 1: 128,262,904 E256K probably benign Het
Xrn1 T C 9: 96,024,191 S1212P probably damaging Het
Zfp408 T C 2: 91,645,537 Y424C possibly damaging Het
Other mutations in Sgk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02318:Sgk1 APN 10 21995541 missense probably damaging 1.00
IGL02670:Sgk1 APN 10 21928546 missense probably benign
IGL03220:Sgk1 APN 10 21997391 missense probably null 1.00
R0010:Sgk1 UTSW 10 21997438 critical splice donor site probably null
R0010:Sgk1 UTSW 10 21997438 critical splice donor site probably null
R0479:Sgk1 UTSW 10 21996310 missense probably benign 0.00
R0650:Sgk1 UTSW 10 21882657 missense probably damaging 0.98
R0652:Sgk1 UTSW 10 21882657 missense probably damaging 0.98
R0688:Sgk1 UTSW 10 21998160 missense probably benign
R0990:Sgk1 UTSW 10 21997086 missense probably damaging 1.00
R1769:Sgk1 UTSW 10 21997108 splice site probably benign
R2009:Sgk1 UTSW 10 21996601 missense probably damaging 1.00
R2218:Sgk1 UTSW 10 21996601 missense probably damaging 1.00
R2314:Sgk1 UTSW 10 21996601 missense probably damaging 1.00
R2909:Sgk1 UTSW 10 21994816 missense probably benign
R2915:Sgk1 UTSW 10 21996601 missense probably damaging 1.00
R3176:Sgk1 UTSW 10 21996601 missense probably damaging 1.00
R3177:Sgk1 UTSW 10 21996601 missense probably damaging 1.00
R3276:Sgk1 UTSW 10 21996601 missense probably damaging 1.00
R3277:Sgk1 UTSW 10 21996601 missense probably damaging 1.00
R3802:Sgk1 UTSW 10 21997412 missense probably damaging 1.00
R5974:Sgk1 UTSW 10 21996249 missense probably damaging 1.00
R6943:Sgk1 UTSW 10 21882694 missense probably damaging 0.99
R7360:Sgk1 UTSW 10 21994073 missense probably benign 0.01
R7425:Sgk1 UTSW 10 21994110 missense probably damaging 0.97
R7665:Sgk1 UTSW 10 21996662 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCCTGGTGAAGAATTTCTACCCTG -3'
(R):5'- TCCCTCTCCAGCATTCAAGGTAGC -3'

Sequencing Primer
(F):5'- GCCCTGTTGAAATCTGAATTTGC -3'
(R):5'- AGGGCACTGGCTATTTCAGC -3'
Posted On2013-05-23