Mutagenetix > Incidental Mutation

Incidental Mutation 'R0467:G3bp1'

41702

Institutional Source

Beutler Lab

Gene Symbol

G3bp1

Ensembl Gene

ENSMUSG00000018583

Gene Name

GTPase activating protein (SH3 domain) binding protein 1

Synonyms

GAP SH3 binding protein

MMRRC Submission

038667-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R0467 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

55469685-55504838 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 55498626 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Leucine at position 383 (F383L)

Ref Sequence

ENSEMBL: ENSMUSP00000018727 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000018727]

AlphaFold

P97855

Predicted Effect

probably damaging
Transcript: ENSMUST00000018727
AA Change: F383L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000018727
Gene: ENSMUSG00000018583
AA Change: F383L

Domain	Start	End	E-Value	Type
Pfam:NTF2	11	133	5.8e-35	PFAM
low complexity region	142	167	N/A	INTRINSIC
low complexity region	187	206	N/A	INTRINSIC
low complexity region	211	225	N/A	INTRINSIC
low complexity region	289	305	N/A	INTRINSIC
RRM	339	409	1.49e-13	SMART
low complexity region	419	447	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000185156

Meta Mutation Damage Score

0.8237

Coding Region Coverage

1x: 99.6%
3x: 98.8%
10x: 96.7%
20x: 93.3%

Validation Efficiency

98% (52/53)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the DNA-unwinding enzymes which prefers partially unwound 3'-tailed substrates and can also unwind partial RNA/DNA and RNA/RNA duplexes in an ATP-dependent fashion. This enzyme is a member of the heterogeneous nuclear RNA-binding proteins and is also an element of the Ras signal transduction pathway. It binds specifically to the Ras-GTPase-activating protein by associating with its SH3 domain. Several alternatively spliced transcript variants of this gene have been described, but the full-length nature of some of these variants has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display perinatal lethality with severe cell death in the nervous system and decreased cell proliferation. Neonates from heterozygous null female mice display increased mortality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700022I11Rik	T	C	4: 42,972,715	S683P	probably benign	Het
2310007B03Rik	A	T	1: 93,153,044	I380N	probably damaging	Het
4931423N10Rik	A	G	2: 23,212,820	E190G	possibly damaging	Het
4933416C03Rik	G	A	10: 116,113,153	A156V	probably benign	Het
Abca17	A	G	17: 24,313,177		probably benign	Het
Anapc1	A	G	2: 128,669,043	I511T	probably damaging	Het
Atf6	A	T	1: 170,794,020	H477Q	probably damaging	Het
C4b	A	G	17: 34,736,127	V795A	probably benign	Het
Cdh26	C	T	2: 178,481,632	R675C	possibly damaging	Het
Cdk12	T	C	11: 98,203,579	V71A	probably damaging	Het
Cul3	A	T	1: 80,280,863	D419E	probably benign	Het
Ddi2	A	G	4: 141,685,184	I139T	probably benign	Het
Dnaaf1	T	A	8: 119,590,732	D333E	probably benign	Het
Dnase1	A	G	16: 4,039,149	D7G	probably damaging	Het
Fam71f1	G	A	6: 29,326,607	S241N	probably damaging	Het
Galc	A	C	12: 98,242,645	I250R	probably damaging	Het
Gcfc2	T	C	6: 81,923,882	V59A	possibly damaging	Het
Gm6133	A	C	18: 78,350,090	S100R	probably benign	Het
Iba57	T	C	11: 59,163,439	T85A	probably benign	Het
Ipo4	A	T	14: 55,635,526	M1K	probably null	Het
Ippk	A	G	13: 49,430,865		probably null	Het
Kcnk10	A	T	12: 98,489,945	I209N	probably benign	Het
Klk14	T	C	7: 43,694,110	L122P	probably benign	Het
Ltbp1	T	A	17: 75,282,429		probably null	Het
Mcm3	T	C	1: 20,804,847	D737G	probably benign	Het
Naip2	A	C	13: 100,161,782	I582S	probably benign	Het
Nalcn	T	A	14: 123,291,047	T1456S	probably benign	Het
Nckap1l	C	T	15: 103,497,427	P1097S	probably benign	Het
Ncoa1	A	G	12: 4,267,687	M1215T	possibly damaging	Het
Nomo1	T	A	7: 46,072,487		probably null	Het
Obox5	T	A	7: 15,758,007	C116S	possibly damaging	Het
Olfr644	C	T	7: 104,068,125	R302H	probably benign	Het
Olfr701	T	A	7: 106,818,361	S93T	possibly damaging	Het
Olfr76	C	A	19: 12,120,536	A59S	probably benign	Het
Pcdhb14	G	T	18: 37,449,224	R461L	probably damaging	Het
Pdgfra	A	G	5: 75,195,036	D1069G	probably damaging	Het
Pgr	C	T	9: 8,900,778	A104V	possibly damaging	Het
Pkd1l3	C	G	8: 109,623,649	D375E	possibly damaging	Het
Rassf3	A	G	10: 121,417,204		probably benign	Het
Rgs22	G	T	15: 36,099,795	S258*	probably null	Het
Rsph6a	C	A	7: 19,057,669	D254E	possibly damaging	Het
Sgk1	A	G	10: 21,996,358		probably benign	Het
Shcbp1l	G	A	1: 153,433,182	C174Y	probably damaging	Het
Sulf1	T	A	1: 12,796,920	N109K	probably damaging	Het
Tas2r115	T	A	6: 132,737,719	I90L	probably benign	Het
Tmem200a	T	C	10: 25,994,104	H89R	probably benign	Het
Ubxn4	G	A	1: 128,262,904	E256K	probably benign	Het
Xrn1	T	C	9: 96,024,191	S1212P	probably damaging	Het
Zfp408	T	C	2: 91,645,537	Y424C	possibly damaging	Het

Other mutations in G3bp1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02231:G3bp1	APN	11	55495447	nonsense	probably null
silverheels	UTSW	11	55489116	missense	possibly damaging	0.95
R0056:G3bp1	UTSW	11	55498041	missense	probably benign	0.03
R0113:G3bp1	UTSW	11	55495426	missense	probably benign	0.00
R0240:G3bp1	UTSW	11	55492028	missense	probably damaging	1.00
R0240:G3bp1	UTSW	11	55492028	missense	probably damaging	1.00
R0311:G3bp1	UTSW	11	55498626	missense	probably damaging	1.00
R0312:G3bp1	UTSW	11	55498626	missense	probably damaging	1.00
R0367:G3bp1	UTSW	11	55498626	missense	probably damaging	1.00
R0368:G3bp1	UTSW	11	55498626	missense	probably damaging	1.00
R0454:G3bp1	UTSW	11	55498626	missense	probably damaging	1.00
R0464:G3bp1	UTSW	11	55498626	missense	probably damaging	1.00
R0465:G3bp1	UTSW	11	55498626	missense	probably damaging	1.00
R0466:G3bp1	UTSW	11	55498626	missense	probably damaging	1.00
R0486:G3bp1	UTSW	11	55498626	missense	probably damaging	1.00
R0487:G3bp1	UTSW	11	55498626	missense	probably damaging	1.00
R0533:G3bp1	UTSW	11	55498626	missense	probably damaging	1.00
R0551:G3bp1	UTSW	11	55489143	missense	probably benign	0.01
R0689:G3bp1	UTSW	11	55498626	missense	probably damaging	1.00
R0848:G3bp1	UTSW	11	55498626	missense	probably damaging	1.00
R2109:G3bp1	UTSW	11	55489160	missense	probably damaging	0.97
R5129:G3bp1	UTSW	11	55489116	missense	possibly damaging	0.95
R5439:G3bp1	UTSW	11	55497987	missense	probably damaging	0.96
R5834:G3bp1	UTSW	11	55497940	missense	probably benign
R6692:G3bp1	UTSW	11	55493509	missense	probably benign	0.00
R6925:G3bp1	UTSW	11	55497960	missense	possibly damaging	0.47
R7091:G3bp1	UTSW	11	55496221	missense	possibly damaging	0.94
R8348:G3bp1	UTSW	11	55498631	missense	possibly damaging	0.81
R9375:G3bp1	UTSW	11	55499613	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TGAGACACAATGCCTTGCCCAC -3'
(R):5'- TCCGAGCTGGAAAATGACACTCAAC -3'

Sequencing Primer
(F):5'- CATCTAAGGAGCTTATCATTGAACTC -3'
(R):5'- acaataggtaactccatgtccag -3'

Posted On

2013-05-23