Incidental Mutation 'R0467:G3bp1'
ID41702
Institutional Source Beutler Lab
Gene Symbol G3bp1
Ensembl Gene ENSMUSG00000018583
Gene NameGTPase activating protein (SH3 domain) binding protein 1
SynonymsGAP SH3 binding protein
MMRRC Submission 038667-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0467 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location55469685-55504838 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 55498626 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 383 (F383L)
Ref Sequence ENSEMBL: ENSMUSP00000018727 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018727]
Predicted Effect probably damaging
Transcript: ENSMUST00000018727
AA Change: F383L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000018727
Gene: ENSMUSG00000018583
AA Change: F383L

DomainStartEndE-ValueType
Pfam:NTF2 11 133 5.8e-35 PFAM
low complexity region 142 167 N/A INTRINSIC
low complexity region 187 206 N/A INTRINSIC
low complexity region 211 225 N/A INTRINSIC
low complexity region 289 305 N/A INTRINSIC
RRM 339 409 1.49e-13 SMART
low complexity region 419 447 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185156
Meta Mutation Damage Score 0.8237 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 96.7%
  • 20x: 93.3%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the DNA-unwinding enzymes which prefers partially unwound 3'-tailed substrates and can also unwind partial RNA/DNA and RNA/RNA duplexes in an ATP-dependent fashion. This enzyme is a member of the heterogeneous nuclear RNA-binding proteins and is also an element of the Ras signal transduction pathway. It binds specifically to the Ras-GTPase-activating protein by associating with its SH3 domain. Several alternatively spliced transcript variants of this gene have been described, but the full-length nature of some of these variants has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display perinatal lethality with severe cell death in the nervous system and decreased cell proliferation. Neonates from heterozygous null female mice display increased mortality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik T C 4: 42,972,715 S683P probably benign Het
2310007B03Rik A T 1: 93,153,044 I380N probably damaging Het
4931423N10Rik A G 2: 23,212,820 E190G possibly damaging Het
4933416C03Rik G A 10: 116,113,153 A156V probably benign Het
Abca17 A G 17: 24,313,177 probably benign Het
Anapc1 A G 2: 128,669,043 I511T probably damaging Het
Atf6 A T 1: 170,794,020 H477Q probably damaging Het
C4b A G 17: 34,736,127 V795A probably benign Het
Cdh26 C T 2: 178,481,632 R675C possibly damaging Het
Cdk12 T C 11: 98,203,579 V71A probably damaging Het
Cul3 A T 1: 80,280,863 D419E probably benign Het
Ddi2 A G 4: 141,685,184 I139T probably benign Het
Dnaaf1 T A 8: 119,590,732 D333E probably benign Het
Dnase1 A G 16: 4,039,149 D7G probably damaging Het
Fam71f1 G A 6: 29,326,607 S241N probably damaging Het
Galc A C 12: 98,242,645 I250R probably damaging Het
Gcfc2 T C 6: 81,923,882 V59A possibly damaging Het
Gm6133 A C 18: 78,350,090 S100R probably benign Het
Iba57 T C 11: 59,163,439 T85A probably benign Het
Ipo4 A T 14: 55,635,526 M1K probably null Het
Ippk A G 13: 49,430,865 probably null Het
Kcnk10 A T 12: 98,489,945 I209N probably benign Het
Klk14 T C 7: 43,694,110 L122P probably benign Het
Ltbp1 T A 17: 75,282,429 probably null Het
Mcm3 T C 1: 20,804,847 D737G probably benign Het
Naip2 A C 13: 100,161,782 I582S probably benign Het
Nalcn T A 14: 123,291,047 T1456S probably benign Het
Nckap1l C T 15: 103,497,427 P1097S probably benign Het
Ncoa1 A G 12: 4,267,687 M1215T possibly damaging Het
Nomo1 T A 7: 46,072,487 probably null Het
Obox5 T A 7: 15,758,007 C116S possibly damaging Het
Olfr644 C T 7: 104,068,125 R302H probably benign Het
Olfr701 T A 7: 106,818,361 S93T possibly damaging Het
Olfr76 C A 19: 12,120,536 A59S probably benign Het
Pcdhb14 G T 18: 37,449,224 R461L probably damaging Het
Pdgfra A G 5: 75,195,036 D1069G probably damaging Het
Pgr C T 9: 8,900,778 A104V possibly damaging Het
Pkd1l3 C G 8: 109,623,649 D375E possibly damaging Het
Rassf3 A G 10: 121,417,204 probably benign Het
Rgs22 G T 15: 36,099,795 S258* probably null Het
Rsph6a C A 7: 19,057,669 D254E possibly damaging Het
Sgk1 A G 10: 21,996,358 probably benign Het
Shcbp1l G A 1: 153,433,182 C174Y probably damaging Het
Sulf1 T A 1: 12,796,920 N109K probably damaging Het
Tas2r115 T A 6: 132,737,719 I90L probably benign Het
Tmem200a T C 10: 25,994,104 H89R probably benign Het
Ubxn4 G A 1: 128,262,904 E256K probably benign Het
Xrn1 T C 9: 96,024,191 S1212P probably damaging Het
Zfp408 T C 2: 91,645,537 Y424C possibly damaging Het
Other mutations in G3bp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02231:G3bp1 APN 11 55495447 nonsense probably null
silverheels UTSW 11 55489116 missense possibly damaging 0.95
R0056:G3bp1 UTSW 11 55498041 missense probably benign 0.03
R0113:G3bp1 UTSW 11 55495426 missense probably benign 0.00
R0240:G3bp1 UTSW 11 55492028 missense probably damaging 1.00
R0240:G3bp1 UTSW 11 55492028 missense probably damaging 1.00
R0311:G3bp1 UTSW 11 55498626 missense probably damaging 1.00
R0312:G3bp1 UTSW 11 55498626 missense probably damaging 1.00
R0367:G3bp1 UTSW 11 55498626 missense probably damaging 1.00
R0368:G3bp1 UTSW 11 55498626 missense probably damaging 1.00
R0454:G3bp1 UTSW 11 55498626 missense probably damaging 1.00
R0464:G3bp1 UTSW 11 55498626 missense probably damaging 1.00
R0465:G3bp1 UTSW 11 55498626 missense probably damaging 1.00
R0466:G3bp1 UTSW 11 55498626 missense probably damaging 1.00
R0486:G3bp1 UTSW 11 55498626 missense probably damaging 1.00
R0487:G3bp1 UTSW 11 55498626 missense probably damaging 1.00
R0533:G3bp1 UTSW 11 55498626 missense probably damaging 1.00
R0551:G3bp1 UTSW 11 55489143 missense probably benign 0.01
R0689:G3bp1 UTSW 11 55498626 missense probably damaging 1.00
R0848:G3bp1 UTSW 11 55498626 missense probably damaging 1.00
R2109:G3bp1 UTSW 11 55489160 missense probably damaging 0.97
R5129:G3bp1 UTSW 11 55489116 missense possibly damaging 0.95
R5439:G3bp1 UTSW 11 55497987 missense probably damaging 0.96
R5834:G3bp1 UTSW 11 55497940 missense probably benign
R6692:G3bp1 UTSW 11 55493509 missense probably benign 0.00
R6925:G3bp1 UTSW 11 55497960 missense possibly damaging 0.47
R7091:G3bp1 UTSW 11 55496221 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TGAGACACAATGCCTTGCCCAC -3'
(R):5'- TCCGAGCTGGAAAATGACACTCAAC -3'

Sequencing Primer
(F):5'- CATCTAAGGAGCTTATCATTGAACTC -3'
(R):5'- acaataggtaactccatgtccag -3'
Posted On2013-05-23