Incidental Mutation 'R0467:Kcnk10'
ID41707
Institutional Source Beutler Lab
Gene Symbol Kcnk10
Ensembl Gene ENSMUSG00000033854
Gene Namepotassium channel, subfamily K, member 10
Synonyms
MMRRC Submission 038667-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock #R0467 (G1)
Quality Score208
Status Validated
Chromosome12
Chromosomal Location98429437-98578310 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 98489945 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 209 (I209N)
Ref Sequence ENSEMBL: ENSMUSP00000152656 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110113] [ENSMUST00000221240] [ENSMUST00000221305]
Predicted Effect probably benign
Transcript: ENSMUST00000110113
AA Change: I192N

PolyPhen 2 Score 0.180 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000105740
Gene: ENSMUSG00000033854
AA Change: I192N

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Pfam:Ion_trans 55 207 9.3e-8 PFAM
Pfam:Ion_trans_2 126 204 3.3e-20 PFAM
Pfam:Ion_trans_2 223 321 8.5e-21 PFAM
low complexity region 449 462 N/A INTRINSIC
low complexity region 479 489 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000221240
AA Change: I206N

PolyPhen 2 Score 0.178 (Sensitivity: 0.92; Specificity: 0.87)
Predicted Effect probably benign
Transcript: ENSMUST00000221305
AA Change: I209N

PolyPhen 2 Score 0.431 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221906
Meta Mutation Damage Score 0.4467 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 96.7%
  • 20x: 93.3%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of potassium channel proteins containing two pore-forming P domains. This channel is an open rectifier which primarily passes outward current under physiological K+ concentrations, and is stimulated strongly by arachidonic acid and to a lesser degree by membrane stretching, intracellular acidification, and general anaesthetics. Several alternatively spliced transcript variants encoding different isoforms have been identified for this gene. [provided by RefSeq, Sep 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit normal glucose hyperpolarization of hypothalamic neurons in response to glucose. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik T C 4: 42,972,715 S683P probably benign Het
2310007B03Rik A T 1: 93,153,044 I380N probably damaging Het
4931423N10Rik A G 2: 23,212,820 E190G possibly damaging Het
4933416C03Rik G A 10: 116,113,153 A156V probably benign Het
Abca17 A G 17: 24,313,177 probably benign Het
Anapc1 A G 2: 128,669,043 I511T probably damaging Het
Atf6 A T 1: 170,794,020 H477Q probably damaging Het
C4b A G 17: 34,736,127 V795A probably benign Het
Cdh26 C T 2: 178,481,632 R675C possibly damaging Het
Cdk12 T C 11: 98,203,579 V71A probably damaging Het
Cul3 A T 1: 80,280,863 D419E probably benign Het
Ddi2 A G 4: 141,685,184 I139T probably benign Het
Dnaaf1 T A 8: 119,590,732 D333E probably benign Het
Dnase1 A G 16: 4,039,149 D7G probably damaging Het
Fam71f1 G A 6: 29,326,607 S241N probably damaging Het
G3bp1 T C 11: 55,498,626 F383L probably damaging Het
Galc A C 12: 98,242,645 I250R probably damaging Het
Gcfc2 T C 6: 81,923,882 V59A possibly damaging Het
Gm6133 A C 18: 78,350,090 S100R probably benign Het
Iba57 T C 11: 59,163,439 T85A probably benign Het
Ipo4 A T 14: 55,635,526 M1K probably null Het
Ippk A G 13: 49,430,865 probably null Het
Klk14 T C 7: 43,694,110 L122P probably benign Het
Ltbp1 T A 17: 75,282,429 probably null Het
Mcm3 T C 1: 20,804,847 D737G probably benign Het
Naip2 A C 13: 100,161,782 I582S probably benign Het
Nalcn T A 14: 123,291,047 T1456S probably benign Het
Nckap1l C T 15: 103,497,427 P1097S probably benign Het
Ncoa1 A G 12: 4,267,687 M1215T possibly damaging Het
Nomo1 T A 7: 46,072,487 probably null Het
Obox5 T A 7: 15,758,007 C116S possibly damaging Het
Olfr644 C T 7: 104,068,125 R302H probably benign Het
Olfr701 T A 7: 106,818,361 S93T possibly damaging Het
Olfr76 C A 19: 12,120,536 A59S probably benign Het
Pcdhb14 G T 18: 37,449,224 R461L probably damaging Het
Pdgfra A G 5: 75,195,036 D1069G probably damaging Het
Pgr C T 9: 8,900,778 A104V possibly damaging Het
Pkd1l3 C G 8: 109,623,649 D375E possibly damaging Het
Rassf3 A G 10: 121,417,204 probably benign Het
Rgs22 G T 15: 36,099,795 S258* probably null Het
Rsph6a C A 7: 19,057,669 D254E possibly damaging Het
Sgk1 A G 10: 21,996,358 probably benign Het
Shcbp1l G A 1: 153,433,182 C174Y probably damaging Het
Sulf1 T A 1: 12,796,920 N109K probably damaging Het
Tas2r115 T A 6: 132,737,719 I90L probably benign Het
Tmem200a T C 10: 25,994,104 H89R probably benign Het
Ubxn4 G A 1: 128,262,904 E256K probably benign Het
Xrn1 T C 9: 96,024,191 S1212P probably damaging Het
Zfp408 T C 2: 91,645,537 Y424C possibly damaging Het
Other mutations in Kcnk10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00977:Kcnk10 APN 12 98518533 missense probably damaging 0.99
IGL01409:Kcnk10 APN 12 98490063 missense probably damaging 1.00
IGL02149:Kcnk10 APN 12 98518840 splice site probably benign
R0558:Kcnk10 UTSW 12 98436301 missense possibly damaging 0.89
R0665:Kcnk10 UTSW 12 98440685 missense probably benign 0.00
R1033:Kcnk10 UTSW 12 98518670 missense possibly damaging 0.93
R1036:Kcnk10 UTSW 12 98496186 splice site probably benign
R1398:Kcnk10 UTSW 12 98436226 missense probably damaging 0.99
R1482:Kcnk10 UTSW 12 98489948 missense probably damaging 0.99
R1675:Kcnk10 UTSW 12 98496288 missense probably benign 0.31
R2858:Kcnk10 UTSW 12 98435289 missense possibly damaging 0.64
R2871:Kcnk10 UTSW 12 98434813 missense probably benign 0.41
R2871:Kcnk10 UTSW 12 98434813 missense probably benign 0.41
R3736:Kcnk10 UTSW 12 98489912 missense probably benign 0.31
R3845:Kcnk10 UTSW 12 98440744 missense probably benign 0.11
R4077:Kcnk10 UTSW 12 98434946 missense probably benign 0.03
R4541:Kcnk10 UTSW 12 98436277 missense probably damaging 1.00
R4605:Kcnk10 UTSW 12 98489960 missense probably damaging 1.00
R4841:Kcnk10 UTSW 12 98434916 missense probably benign 0.00
R4842:Kcnk10 UTSW 12 98434916 missense probably benign 0.00
R4886:Kcnk10 UTSW 12 98435159 missense possibly damaging 0.89
R4968:Kcnk10 UTSW 12 98434902 missense probably benign 0.01
R4977:Kcnk10 UTSW 12 98440687 missense probably benign 0.07
R5108:Kcnk10 UTSW 12 98435301 missense probably benign 0.39
R5166:Kcnk10 UTSW 12 98434995 missense probably damaging 0.98
R5936:Kcnk10 UTSW 12 98489932 missense probably benign 0.12
R6193:Kcnk10 UTSW 12 98440772 missense probably benign 0.07
R7107:Kcnk10 UTSW 12 98518743 nonsense probably null
R7611:Kcnk10 UTSW 12 98518640 missense probably damaging 1.00
R7687:Kcnk10 UTSW 12 98435096 missense probably damaging 0.97
R8225:Kcnk10 UTSW 12 98440590 critical splice donor site probably null
R8270:Kcnk10 UTSW 12 98435099 missense
X0067:Kcnk10 UTSW 12 98518824 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- GTCCTCTGTCCACATCCTCGAAAAG -3'
(R):5'- TTCACTGCCTATTACTCCGTGAAAGC -3'

Sequencing Primer
(F):5'- GAGAAAACACATCATAGCATTCAAC -3'
(R):5'- GCCATTCAATGGTGTCCATGATAG -3'
Posted On2013-05-23