Incidental Mutation 'R0467:Dnase1'
ID41713
Institutional Source Beutler Lab
Gene Symbol Dnase1
Ensembl Gene ENSMUSG00000005980
Gene Namedeoxyribonuclease I
SynonymsDNaseI, Dnl1
MMRRC Submission 038667-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.628) question?
Stock #R0467 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location4036942-4040024 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 4039149 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 7 (D7G)
Ref Sequence ENSEMBL: ENSMUSP00000135060 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006136] [ENSMUST00000006137] [ENSMUST00000120009] [ENSMUST00000137748] [ENSMUST00000157044] [ENSMUST00000175755] [ENSMUST00000177337]
Predicted Effect probably damaging
Transcript: ENSMUST00000006136
AA Change: D190G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000006136
Gene: ENSMUSG00000005980
AA Change: D190G

DomainStartEndE-ValueType
DNaseIc 6 282 5.04e-220 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000006137
SMART Domains Protein: ENSMUSP00000006137
Gene: ENSMUSG00000005981

DomainStartEndE-ValueType
HATPase_c 110 263 3.68e-3 SMART
Pfam:HSP90 290 706 2.6e-98 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000120009
AA Change: D190G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113119
Gene: ENSMUSG00000005980
AA Change: D190G

DomainStartEndE-ValueType
DNaseIc 6 282 5.04e-220 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125961
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132466
Predicted Effect probably damaging
Transcript: ENSMUST00000137748
AA Change: D190G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000119934
Gene: ENSMUSG00000005980
AA Change: D190G

DomainStartEndE-ValueType
DNaseIc 6 225 7.51e-146 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137945
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139334
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144792
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149670
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150906
Predicted Effect probably benign
Transcript: ENSMUST00000157044
SMART Domains Protein: ENSMUSP00000120642
Gene: ENSMUSG00000005980

DomainStartEndE-ValueType
DNaseIc 6 70 4.5e-5 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000175755
AA Change: D7G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135060
Gene: ENSMUSG00000005980
AA Change: D7G

DomainStartEndE-ValueType
SCOP:d2dnja_ 1 52 3e-9 SMART
Blast:DNaseIc 1 61 2e-31 BLAST
PDB:3W3D|B 1 61 5e-27 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176642
Predicted Effect silent
Transcript: ENSMUST00000177337
SMART Domains Protein: ENSMUSP00000135442
Gene: ENSMUSG00000005980

DomainStartEndE-ValueType
DNaseIc 6 200 6.86e-67 SMART
Meta Mutation Damage Score 0.9620 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 96.7%
  • 20x: 93.3%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the DNase family. This protein is stored in the zymogen granules of the nuclear envelope and functions by cleaving DNA in an endonucleolytic manner. At least six autosomal codominant alleles have been characterized, DNASE1*1 through DNASE1*6, and the sequence of DNASE1*2 represented in this record. Mutations in this gene have been associated with systemic lupus erythematosus (SLE), an autoimmune disease. A recombinant form of this protein is used to treat the one of the symptoms of cystic fibrosis by hydrolyzing the extracellular DNA in sputum and reducing its viscosity. Alternate transcriptional splice variants of this gene have been observed but have not been thoroughly characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Some heterozygote and homozygote null mice have autoimmune symptoms similar to systemic lupus erythematosus. These include enlarged lymph nodes, circulating auto-antibodies, kidney inflammation and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik T C 4: 42,972,715 S683P probably benign Het
2310007B03Rik A T 1: 93,153,044 I380N probably damaging Het
4931423N10Rik A G 2: 23,212,820 E190G possibly damaging Het
4933416C03Rik G A 10: 116,113,153 A156V probably benign Het
Abca17 A G 17: 24,313,177 probably benign Het
Anapc1 A G 2: 128,669,043 I511T probably damaging Het
Atf6 A T 1: 170,794,020 H477Q probably damaging Het
C4b A G 17: 34,736,127 V795A probably benign Het
Cdh26 C T 2: 178,481,632 R675C possibly damaging Het
Cdk12 T C 11: 98,203,579 V71A probably damaging Het
Cul3 A T 1: 80,280,863 D419E probably benign Het
Ddi2 A G 4: 141,685,184 I139T probably benign Het
Dnaaf1 T A 8: 119,590,732 D333E probably benign Het
Fam71f1 G A 6: 29,326,607 S241N probably damaging Het
G3bp1 T C 11: 55,498,626 F383L probably damaging Het
Galc A C 12: 98,242,645 I250R probably damaging Het
Gcfc2 T C 6: 81,923,882 V59A possibly damaging Het
Gm6133 A C 18: 78,350,090 S100R probably benign Het
Iba57 T C 11: 59,163,439 T85A probably benign Het
Ipo4 A T 14: 55,635,526 M1K probably null Het
Ippk A G 13: 49,430,865 probably null Het
Kcnk10 A T 12: 98,489,945 I209N probably benign Het
Klk14 T C 7: 43,694,110 L122P probably benign Het
Ltbp1 T A 17: 75,282,429 probably null Het
Mcm3 T C 1: 20,804,847 D737G probably benign Het
Naip2 A C 13: 100,161,782 I582S probably benign Het
Nalcn T A 14: 123,291,047 T1456S probably benign Het
Nckap1l C T 15: 103,497,427 P1097S probably benign Het
Ncoa1 A G 12: 4,267,687 M1215T possibly damaging Het
Nomo1 T A 7: 46,072,487 probably null Het
Obox5 T A 7: 15,758,007 C116S possibly damaging Het
Olfr644 C T 7: 104,068,125 R302H probably benign Het
Olfr701 T A 7: 106,818,361 S93T possibly damaging Het
Olfr76 C A 19: 12,120,536 A59S probably benign Het
Pcdhb14 G T 18: 37,449,224 R461L probably damaging Het
Pdgfra A G 5: 75,195,036 D1069G probably damaging Het
Pgr C T 9: 8,900,778 A104V possibly damaging Het
Pkd1l3 C G 8: 109,623,649 D375E possibly damaging Het
Rassf3 A G 10: 121,417,204 probably benign Het
Rgs22 G T 15: 36,099,795 S258* probably null Het
Rsph6a C A 7: 19,057,669 D254E possibly damaging Het
Sgk1 A G 10: 21,996,358 probably benign Het
Shcbp1l G A 1: 153,433,182 C174Y probably damaging Het
Sulf1 T A 1: 12,796,920 N109K probably damaging Het
Tas2r115 T A 6: 132,737,719 I90L probably benign Het
Tmem200a T C 10: 25,994,104 H89R probably benign Het
Ubxn4 G A 1: 128,262,904 E256K probably benign Het
Xrn1 T C 9: 96,024,191 S1212P probably damaging Het
Zfp408 T C 2: 91,645,537 Y424C possibly damaging Het
Other mutations in Dnase1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00649:Dnase1 APN 16 4039024 missense probably damaging 1.00
IGL00896:Dnase1 APN 16 4039212 missense probably benign 0.00
IGL00983:Dnase1 APN 16 4039553 missense possibly damaging 0.70
IGL02186:Dnase1 APN 16 4039032 missense probably benign 0.18
IGL03373:Dnase1 APN 16 4039843 missense probably damaging 1.00
R0009:Dnase1 UTSW 16 4038946 missense probably damaging 1.00
R0009:Dnase1 UTSW 16 4038946 missense probably damaging 1.00
R0355:Dnase1 UTSW 16 4039549 missense probably damaging 1.00
R4964:Dnase1 UTSW 16 4037907 intron probably benign
R4966:Dnase1 UTSW 16 4037907 intron probably benign
R5014:Dnase1 UTSW 16 4039016 nonsense probably null
R5621:Dnase1 UTSW 16 4039118 missense probably benign 0.01
R5858:Dnase1 UTSW 16 4039649 splice site probably benign
R6256:Dnase1 UTSW 16 4037621 missense probably benign 0.06
R6519:Dnase1 UTSW 16 4038589 missense probably damaging 1.00
R7002:Dnase1 UTSW 16 4039546 missense possibly damaging 0.76
R8050:Dnase1 UTSW 16 4037997 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCACCTCTGCTCGAAGCTAAAACC -3'
(R):5'- TTGGGGCTGCTCACCTGTCATAAG -3'

Sequencing Primer
(F):5'- TCCTCAGAGGTCCAAGAATTTGC -3'
(R):5'- TCACCTGTCATAAGCACAGTG -3'
Posted On2013-05-23