Incidental Mutation 'R0468:Steap3'
ID41721
Institutional Source Beutler Lab
Gene Symbol Steap3
Ensembl Gene ENSMUSG00000026389
Gene NameSTEAP family member 3
SynonymspHyde, 1010001D01Rik
MMRRC Submission 038668-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0468 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location120190757-120272705 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 120234300 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 414 (V414D)
Ref Sequence ENSEMBL: ENSMUSP00000108262 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112639] [ENSMUST00000112640] [ENSMUST00000112641] [ENSMUST00000112643] [ENSMUST00000140490]
Predicted Effect probably damaging
Transcript: ENSMUST00000112639
AA Change: V376D

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000108258
Gene: ENSMUSG00000026389
AA Change: V376D

DomainStartEndE-ValueType
Pfam:F420_oxidored 30 117 5.7e-19 PFAM
Pfam:Ferric_reduct 259 407 1.2e-19 PFAM
transmembrane domain 432 454 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112640
AA Change: V376D

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000108259
Gene: ENSMUSG00000026389
AA Change: V376D

DomainStartEndE-ValueType
Pfam:F420_oxidored 30 117 5.7e-19 PFAM
Pfam:Ferric_reduct 259 407 1.2e-19 PFAM
transmembrane domain 432 454 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112641
AA Change: V376D

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000108260
Gene: ENSMUSG00000026389
AA Change: V376D

DomainStartEndE-ValueType
Pfam:F420_oxidored 30 117 5.7e-19 PFAM
Pfam:Ferric_reduct 259 407 1.2e-19 PFAM
transmembrane domain 432 454 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112643
AA Change: V414D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000108262
Gene: ENSMUSG00000026389
AA Change: V414D

DomainStartEndE-ValueType
Pfam:F420_oxidored 68 155 7.3e-19 PFAM
Pfam:Ferric_reduct 297 445 7.9e-15 PFAM
transmembrane domain 470 492 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000140490
AA Change: V376D

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000121046
Gene: ENSMUSG00000026389
AA Change: V376D

DomainStartEndE-ValueType
Pfam:F420_oxidored 30 117 1.6e-18 PFAM
Pfam:Ferric_reduct 259 406 3.6e-20 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.2%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a multipass membrane protein that functions as an iron transporter. The encoded protein can reduce both iron (Fe3+) and copper (Cu2+) cations. This protein may mediate downstream responses to p53, including promoting apoptosis. Deficiency in this gene can cause anemia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2015]
PHENOTYPE: Homozygous inactivation of this gene results in microcytic anemia, increased erythrocyte cell number, abnormal reticulocyte morphology, anisopoikilocytosis, decreased mean corpuscular hemoglobin, decreased mean corpuscular volume, and thrombocytosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik A G 12: 71,193,310 H1298R possibly damaging Het
5530400C23Rik T C 6: 133,294,458 L155P probably benign Het
6820408C15Rik A T 2: 152,441,266 R283S probably benign Het
Aldh1l2 T A 10: 83,518,678 E104D probably benign Het
Anxa3 T C 5: 96,811,099 V22A probably benign Het
Bcl7b T C 5: 135,180,883 F188L probably benign Het
Brinp1 T A 4: 68,762,776 I506F probably damaging Het
Bsdc1 T C 4: 129,461,718 probably benign Het
Ccdc180 T C 4: 45,923,271 I1075T possibly damaging Het
Cep162 A G 9: 87,193,697 L1294P probably damaging Het
Cltc G A 11: 86,704,626 probably benign Het
Col11a1 T C 3: 114,217,058 probably benign Het
Col14a1 A T 15: 55,388,646 Y566F unknown Het
Dhx29 A G 13: 112,963,277 Q1148R probably benign Het
Ehbp1 A G 11: 22,169,184 probably benign Het
Ehd3 A G 17: 73,805,379 H46R probably damaging Het
Fam171a1 T C 2: 3,225,396 V522A probably benign Het
Gm4553 C A 7: 142,165,625 C22F unknown Het
Hibadh C T 6: 52,557,770 probably benign Het
Hspg2 G A 4: 137,533,529 C1613Y probably damaging Het
Hydin G T 8: 110,413,223 C708F possibly damaging Het
Ifi208 A T 1: 173,683,481 M401L probably benign Het
Igsf8 G A 1: 172,318,796 V454M probably damaging Het
Irx4 G T 13: 73,266,720 probably benign Het
Kcnh4 C T 11: 100,746,932 G633E probably benign Het
Kcnn2 C T 18: 45,559,471 T38M possibly damaging Het
L3mbtl3 C T 10: 26,327,732 R400H unknown Het
Lrp6 T C 6: 134,485,661 T679A possibly damaging Het
Map9 T C 3: 82,374,203 probably null Het
Men1 T A 19: 6,336,923 V5E probably null Het
Mettl14 T C 3: 123,371,412 D93G probably damaging Het
Neb G T 2: 52,211,556 R4601S probably damaging Het
Nell1 A G 7: 50,228,846 T272A probably damaging Het
Olfr1115 A T 2: 87,252,255 N106I probably benign Het
Olfr319 A T 11: 58,701,793 I31F probably damaging Het
Pclo C A 5: 14,677,288 probably benign Het
Pdia5 A G 16: 35,397,507 L502P probably damaging Het
Pkd1l3 C G 8: 109,623,649 D375E possibly damaging Het
Plxna4 C A 6: 32,215,246 C803F probably damaging Het
Pmfbp1 A G 8: 109,513,968 probably null Het
Ptgs1 A G 2: 36,249,193 Y468C probably damaging Het
Pxdn G T 12: 29,994,486 G488W probably damaging Het
Safb C T 17: 56,606,025 R914C probably damaging Het
Sec31b T A 19: 44,518,508 probably benign Het
Shank3 G A 15: 89,549,275 V1333I probably benign Het
Slamf1 A G 1: 171,792,371 probably benign Het
Slc23a3 T A 1: 75,133,230 Q131L possibly damaging Het
Slc7a11 A G 3: 50,384,051 V303A probably damaging Het
Slc7a13 T A 4: 19,841,500 V449D probably benign Het
Srp68 A T 11: 116,248,764 I453K probably damaging Het
Tagln2 A G 1: 172,506,221 N131D probably benign Het
Tmem132d T C 5: 128,269,203 Y85C probably damaging Het
Vcam1 A T 3: 116,115,946 Y577* probably null Het
Vmn1r214 A G 13: 23,035,253 T306A probably benign Het
Zfyve1 A T 12: 83,555,274 probably benign Het
Zgrf1 T A 3: 127,562,041 N305K possibly damaging Het
Other mutations in Steap3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01898:Steap3 APN 1 120241574 missense probably benign 0.02
IGL02307:Steap3 APN 1 120241660 nonsense probably null
IGL02413:Steap3 APN 1 120241772 missense probably damaging 0.99
IGL03237:Steap3 APN 1 120243790 missense probably damaging 1.00
R0076:Steap3 UTSW 1 120227730 missense probably damaging 1.00
R0157:Steap3 UTSW 1 120227649 makesense probably null
R0507:Steap3 UTSW 1 120241583 missense possibly damaging 0.78
R0727:Steap3 UTSW 1 120227817 missense possibly damaging 0.91
R0742:Steap3 UTSW 1 120241583 missense possibly damaging 0.78
R1439:Steap3 UTSW 1 120227820 missense probably damaging 1.00
R1728:Steap3 UTSW 1 120227750 missense probably benign 0.00
R1728:Steap3 UTSW 1 120234378 missense probably benign
R1729:Steap3 UTSW 1 120227750 missense probably benign 0.00
R1729:Steap3 UTSW 1 120234378 missense probably benign
R1730:Steap3 UTSW 1 120227750 missense probably benign 0.00
R1730:Steap3 UTSW 1 120234378 missense probably benign
R1739:Steap3 UTSW 1 120227750 missense probably benign 0.00
R1739:Steap3 UTSW 1 120234378 missense probably benign
R1762:Steap3 UTSW 1 120227750 missense probably benign 0.00
R1762:Steap3 UTSW 1 120234378 missense probably benign
R1783:Steap3 UTSW 1 120227750 missense probably benign 0.00
R1783:Steap3 UTSW 1 120234378 missense probably benign
R1785:Steap3 UTSW 1 120227750 missense probably benign 0.00
R1785:Steap3 UTSW 1 120234378 missense probably benign
R1902:Steap3 UTSW 1 120241734 missense probably benign
R3827:Steap3 UTSW 1 120227730 missense probably damaging 1.00
R4574:Steap3 UTSW 1 120241456 missense probably benign 0.00
R4805:Steap3 UTSW 1 120243886 missense probably benign 0.04
R5176:Steap3 UTSW 1 120243767 critical splice donor site probably null
R5285:Steap3 UTSW 1 120241880 missense probably damaging 0.98
R5481:Steap3 UTSW 1 120241724 missense probably benign
R5906:Steap3 UTSW 1 120244001 missense probably damaging 1.00
R6038:Steap3 UTSW 1 120241641 missense probably damaging 1.00
R6038:Steap3 UTSW 1 120241641 missense probably damaging 1.00
R6922:Steap3 UTSW 1 120243894 missense probably damaging 1.00
R7258:Steap3 UTSW 1 120243986 missense possibly damaging 0.73
R7278:Steap3 UTSW 1 120234357 missense probably damaging 0.97
R7315:Steap3 UTSW 1 120227912 missense probably benign 0.01
R7439:Steap3 UTSW 1 120241518 missense probably benign 0.31
R7440:Steap3 UTSW 1 120241518 missense probably benign 0.31
R7441:Steap3 UTSW 1 120241518 missense probably benign 0.31
R7444:Steap3 UTSW 1 120241518 missense probably benign 0.31
R7452:Steap3 UTSW 1 120227855 missense possibly damaging 0.47
R8331:Steap3 UTSW 1 120241488 missense possibly damaging 0.78
Z1176:Steap3 UTSW 1 120241623 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGACAGACTTCCCAGGGTCAGAAAG -3'
(R):5'- AGCCATCTGGCAGAGCATGAAC -3'

Sequencing Primer
(F):5'- CTTGTCCTGAGCAAGTTGAAGC -3'
(R):5'- GAACATAACCGTGGCTCTCTTG -3'
Posted On2013-05-23