Incidental Mutation 'R0468:Tagln2'
ID41724
Institutional Source Beutler Lab
Gene Symbol Tagln2
Ensembl Gene ENSMUSG00000026547
Gene Nametransgelin 2
SynonymsSm22B, 2700094C18Rik
MMRRC Submission 038668-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0468 (G1)
Quality Score203
Status Validated
Chromosome1
Chromosomal Location172500047-172507380 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 172506221 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 131 (N131D)
Ref Sequence ENSEMBL: ENSMUSP00000106861 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111228] [ENSMUST00000111230] [ENSMUST00000192460]
Predicted Effect probably benign
Transcript: ENSMUST00000111228
AA Change: N131D

PolyPhen 2 Score 0.229 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000106859
Gene: ENSMUSG00000026547
AA Change: N131D

DomainStartEndE-ValueType
CH 26 132 2.84e-24 SMART
Pfam:Calponin 174 198 7e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111230
AA Change: N131D

PolyPhen 2 Score 0.229 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000106861
Gene: ENSMUSG00000026547
AA Change: N131D

DomainStartEndE-ValueType
CH 26 132 2.84e-24 SMART
Pfam:Calponin 174 199 1.6e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138296
Predicted Effect probably benign
Transcript: ENSMUST00000192460
SMART Domains Protein: ENSMUSP00000141983
Gene: ENSMUSG00000026547

DomainStartEndE-ValueType
Pfam:CH 27 90 9.2e-10 PFAM
Meta Mutation Damage Score 0.4263 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.2%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is similar to the protein transgelin, which is one of the earliest markers of differentiated smooth muscle. The specific function of this protein has not yet been determined, although it is thought to be a tumor suppressor. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2013]
PHENOTYPE: Mice homozygous for a null allele display abnormalities in T cell physiology including cytotoxicity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik A G 12: 71,193,310 H1298R possibly damaging Het
5530400C23Rik T C 6: 133,294,458 L155P probably benign Het
6820408C15Rik A T 2: 152,441,266 R283S probably benign Het
Aldh1l2 T A 10: 83,518,678 E104D probably benign Het
Anxa3 T C 5: 96,811,099 V22A probably benign Het
Bcl7b T C 5: 135,180,883 F188L probably benign Het
Brinp1 T A 4: 68,762,776 I506F probably damaging Het
Bsdc1 T C 4: 129,461,718 probably benign Het
Ccdc180 T C 4: 45,923,271 I1075T possibly damaging Het
Cep162 A G 9: 87,193,697 L1294P probably damaging Het
Cltc G A 11: 86,704,626 probably benign Het
Col11a1 T C 3: 114,217,058 probably benign Het
Col14a1 A T 15: 55,388,646 Y566F unknown Het
Dhx29 A G 13: 112,963,277 Q1148R probably benign Het
Ehbp1 A G 11: 22,169,184 probably benign Het
Ehd3 A G 17: 73,805,379 H46R probably damaging Het
Fam171a1 T C 2: 3,225,396 V522A probably benign Het
Gm4553 C A 7: 142,165,625 C22F unknown Het
Hibadh C T 6: 52,557,770 probably benign Het
Hspg2 G A 4: 137,533,529 C1613Y probably damaging Het
Hydin G T 8: 110,413,223 C708F possibly damaging Het
Ifi208 A T 1: 173,683,481 M401L probably benign Het
Igsf8 G A 1: 172,318,796 V454M probably damaging Het
Irx4 G T 13: 73,266,720 probably benign Het
Kcnh4 C T 11: 100,746,932 G633E probably benign Het
Kcnn2 C T 18: 45,559,471 T38M possibly damaging Het
L3mbtl3 C T 10: 26,327,732 R400H unknown Het
Lrp6 T C 6: 134,485,661 T679A possibly damaging Het
Map9 T C 3: 82,374,203 probably null Het
Men1 T A 19: 6,336,923 V5E probably null Het
Mettl14 T C 3: 123,371,412 D93G probably damaging Het
Neb G T 2: 52,211,556 R4601S probably damaging Het
Nell1 A G 7: 50,228,846 T272A probably damaging Het
Olfr1115 A T 2: 87,252,255 N106I probably benign Het
Olfr319 A T 11: 58,701,793 I31F probably damaging Het
Pclo C A 5: 14,677,288 probably benign Het
Pdia5 A G 16: 35,397,507 L502P probably damaging Het
Pkd1l3 C G 8: 109,623,649 D375E possibly damaging Het
Plxna4 C A 6: 32,215,246 C803F probably damaging Het
Pmfbp1 A G 8: 109,513,968 probably null Het
Ptgs1 A G 2: 36,249,193 Y468C probably damaging Het
Pxdn G T 12: 29,994,486 G488W probably damaging Het
Safb C T 17: 56,606,025 R914C probably damaging Het
Sec31b T A 19: 44,518,508 probably benign Het
Shank3 G A 15: 89,549,275 V1333I probably benign Het
Slamf1 A G 1: 171,792,371 probably benign Het
Slc23a3 T A 1: 75,133,230 Q131L possibly damaging Het
Slc7a11 A G 3: 50,384,051 V303A probably damaging Het
Slc7a13 T A 4: 19,841,500 V449D probably benign Het
Srp68 A T 11: 116,248,764 I453K probably damaging Het
Steap3 A T 1: 120,234,300 V414D probably damaging Het
Tmem132d T C 5: 128,269,203 Y85C probably damaging Het
Vcam1 A T 3: 116,115,946 Y577* probably null Het
Vmn1r214 A G 13: 23,035,253 T306A probably benign Het
Zfyve1 A T 12: 83,555,274 probably benign Het
Zgrf1 T A 3: 127,562,041 N305K possibly damaging Het
Other mutations in Tagln2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1576:Tagln2 UTSW 1 172505221 missense probably benign 0.02
R5680:Tagln2 UTSW 1 172505912 missense probably damaging 1.00
R6860:Tagln2 UTSW 1 172505909 missense probably benign 0.32
R7149:Tagln2 UTSW 1 172505819 missense probably damaging 0.98
R7554:Tagln2 UTSW 1 172505844 missense probably damaging 1.00
R7977:Tagln2 UTSW 1 172505253 missense probably benign
R7987:Tagln2 UTSW 1 172505253 missense probably benign
R8083:Tagln2 UTSW 1 172505199 missense possibly damaging 0.96
Predicted Primers PCR Primer
(F):5'- GAGATCAAGGATGGGCCATACTGC -3'
(R):5'- TGACACCCACTCTGCTTCTGAGAC -3'

Sequencing Primer
(F):5'- TGCAGGTTGAGGTTGAAACAATG -3'
(R):5'- ccaccaccaccaccacc -3'
Posted On2013-05-23