Incidental Mutation 'R0468:Ifi208'
ID41725
Institutional Source Beutler Lab
Gene Symbol Ifi208
Ensembl Gene ENSMUSG00000066677
Gene Nameinterferon activated gene 208
SynonymsPydc3, E430029J22Rik, Pyr-rv1
MMRRC Submission 038668-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0468 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location173673675-173698395 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 173683481 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 401 (M401L)
Ref Sequence ENSEMBL: ENSMUSP00000128958 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085876] [ENSMUST00000169857]
Predicted Effect probably benign
Transcript: ENSMUST00000085876
AA Change: M401L

PolyPhen 2 Score 0.083 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000083039
Gene: ENSMUSG00000066677
AA Change: M401L

DomainStartEndE-ValueType
PYRIN 10 88 3.23e-20 SMART
low complexity region 101 112 N/A INTRINSIC
low complexity region 211 222 N/A INTRINSIC
low complexity region 488 504 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169857
AA Change: M401L

PolyPhen 2 Score 0.083 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000128958
Gene: ENSMUSG00000066677
AA Change: M401L

DomainStartEndE-ValueType
PYRIN 10 88 3.23e-20 SMART
low complexity region 101 112 N/A INTRINSIC
low complexity region 211 222 N/A INTRINSIC
Pfam:HERV-K_REC 502 580 3.5e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182880
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.2%
Validation Efficiency 100% (61/61)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik A G 12: 71,193,310 H1298R possibly damaging Het
5530400C23Rik T C 6: 133,294,458 L155P probably benign Het
6820408C15Rik A T 2: 152,441,266 R283S probably benign Het
Aldh1l2 T A 10: 83,518,678 E104D probably benign Het
Anxa3 T C 5: 96,811,099 V22A probably benign Het
Bcl7b T C 5: 135,180,883 F188L probably benign Het
Brinp1 T A 4: 68,762,776 I506F probably damaging Het
Bsdc1 T C 4: 129,461,718 probably benign Het
Ccdc180 T C 4: 45,923,271 I1075T possibly damaging Het
Cep162 A G 9: 87,193,697 L1294P probably damaging Het
Cltc G A 11: 86,704,626 probably benign Het
Col11a1 T C 3: 114,217,058 probably benign Het
Col14a1 A T 15: 55,388,646 Y566F unknown Het
Dhx29 A G 13: 112,963,277 Q1148R probably benign Het
Ehbp1 A G 11: 22,169,184 probably benign Het
Ehd3 A G 17: 73,805,379 H46R probably damaging Het
Fam171a1 T C 2: 3,225,396 V522A probably benign Het
Gm4553 C A 7: 142,165,625 C22F unknown Het
Hibadh C T 6: 52,557,770 probably benign Het
Hspg2 G A 4: 137,533,529 C1613Y probably damaging Het
Hydin G T 8: 110,413,223 C708F possibly damaging Het
Igsf8 G A 1: 172,318,796 V454M probably damaging Het
Irx4 G T 13: 73,266,720 probably benign Het
Kcnh4 C T 11: 100,746,932 G633E probably benign Het
Kcnn2 C T 18: 45,559,471 T38M possibly damaging Het
L3mbtl3 C T 10: 26,327,732 R400H unknown Het
Lrp6 T C 6: 134,485,661 T679A possibly damaging Het
Map9 T C 3: 82,374,203 probably null Het
Men1 T A 19: 6,336,923 V5E probably null Het
Mettl14 T C 3: 123,371,412 D93G probably damaging Het
Neb G T 2: 52,211,556 R4601S probably damaging Het
Nell1 A G 7: 50,228,846 T272A probably damaging Het
Olfr1115 A T 2: 87,252,255 N106I probably benign Het
Olfr319 A T 11: 58,701,793 I31F probably damaging Het
Pclo C A 5: 14,677,288 probably benign Het
Pdia5 A G 16: 35,397,507 L502P probably damaging Het
Pkd1l3 C G 8: 109,623,649 D375E possibly damaging Het
Plxna4 C A 6: 32,215,246 C803F probably damaging Het
Pmfbp1 A G 8: 109,513,968 probably null Het
Ptgs1 A G 2: 36,249,193 Y468C probably damaging Het
Pxdn G T 12: 29,994,486 G488W probably damaging Het
Safb C T 17: 56,606,025 R914C probably damaging Het
Sec31b T A 19: 44,518,508 probably benign Het
Shank3 G A 15: 89,549,275 V1333I probably benign Het
Slamf1 A G 1: 171,792,371 probably benign Het
Slc23a3 T A 1: 75,133,230 Q131L possibly damaging Het
Slc7a11 A G 3: 50,384,051 V303A probably damaging Het
Slc7a13 T A 4: 19,841,500 V449D probably benign Het
Srp68 A T 11: 116,248,764 I453K probably damaging Het
Steap3 A T 1: 120,234,300 V414D probably damaging Het
Tagln2 A G 1: 172,506,221 N131D probably benign Het
Tmem132d T C 5: 128,269,203 Y85C probably damaging Het
Vcam1 A T 3: 116,115,946 Y577* probably null Het
Vmn1r214 A G 13: 23,035,253 T306A probably benign Het
Zfyve1 A T 12: 83,555,274 probably benign Het
Zgrf1 T A 3: 127,562,041 N305K possibly damaging Het
Other mutations in Ifi208
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Ifi208 APN 1 173679038 critical splice donor site probably null
IGL00725:Ifi208 APN 1 173682861 missense possibly damaging 0.86
IGL01952:Ifi208 APN 1 173679031 missense possibly damaging 0.93
IGL02024:Ifi208 APN 1 173683290 missense probably damaging 0.99
IGL02637:Ifi208 APN 1 173678942 missense probably benign 0.15
IGL02829:Ifi208 APN 1 173682840 missense probably damaging 0.99
IGL03216:Ifi208 APN 1 173678941 missense possibly damaging 0.68
IGL03398:Ifi208 APN 1 173683251 missense probably damaging 0.96
FR4304:Ifi208 UTSW 1 173677698 small deletion probably benign
FR4340:Ifi208 UTSW 1 173677698 small deletion probably benign
FR4342:Ifi208 UTSW 1 173677698 small deletion probably benign
R0022:Ifi208 UTSW 1 173683046 missense possibly damaging 0.91
R0734:Ifi208 UTSW 1 173683335 missense probably damaging 0.98
R0780:Ifi208 UTSW 1 173682696 missense probably benign 0.06
R1070:Ifi208 UTSW 1 173683044 missense probably damaging 0.99
R1339:Ifi208 UTSW 1 173683238 missense probably damaging 0.99
R1473:Ifi208 UTSW 1 173695654 missense possibly damaging 0.53
R1755:Ifi208 UTSW 1 173677910 missense possibly damaging 0.86
R3012:Ifi208 UTSW 1 173695570 critical splice acceptor site probably null
R3692:Ifi208 UTSW 1 173682872 missense possibly damaging 0.93
R4175:Ifi208 UTSW 1 173682701 missense probably benign 0.01
R4235:Ifi208 UTSW 1 173682911 missense probably benign 0.06
R4749:Ifi208 UTSW 1 173695614 missense possibly damaging 0.70
R4815:Ifi208 UTSW 1 173682837 missense probably damaging 0.96
R5116:Ifi208 UTSW 1 173677983 intron probably benign
R5138:Ifi208 UTSW 1 173690673 missense probably null 0.29
R5210:Ifi208 UTSW 1 173683265 missense probably benign
R5304:Ifi208 UTSW 1 173683608 missense probably benign
R6126:Ifi208 UTSW 1 173677708 missense possibly damaging 0.91
R6558:Ifi208 UTSW 1 173683023 missense probably damaging 0.99
R6915:Ifi208 UTSW 1 173682878 missense probably damaging 1.00
R7513:Ifi208 UTSW 1 173695654 nonsense probably null
R7972:Ifi208 UTSW 1 173678990 missense possibly damaging 0.68
R8143:Ifi208 UTSW 1 173682676 missense possibly damaging 0.91
R8383:Ifi208 UTSW 1 173683509 missense possibly damaging 0.93
R8431:Ifi208 UTSW 1 173683278 missense possibly damaging 0.85
RF027:Ifi208 UTSW 1 173677696 small deletion probably benign
RF029:Ifi208 UTSW 1 173677696 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- GTTTCATTAAACCTCAGGTGACCCCAG -3'
(R):5'- CCAGTCATTACCTTGAGTGGCTTTGC -3'

Sequencing Primer
(F):5'- GCAGTTACAGTAACCCTCAGGTG -3'
(R):5'- GCTTTGCTGGAGACAGAGAC -3'
Posted On2013-05-23