Incidental Mutation 'R0468:Ptgs1'
ID41727
Institutional Source Beutler Lab
Gene Symbol Ptgs1
Ensembl Gene ENSMUSG00000047250
Gene Nameprostaglandin-endoperoxide synthase 1
SynonymsPghs1, Cox-3, COX1, Cox-1, cyclooxygenase 1
MMRRC Submission 038668-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.403) question?
Stock #R0468 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location36230426-36252272 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 36249193 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 468 (Y468C)
Ref Sequence ENSEMBL: ENSMUSP00000059977 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062069]
Predicted Effect probably damaging
Transcript: ENSMUST00000062069
AA Change: Y468C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000059977
Gene: ENSMUSG00000047250
AA Change: Y468C

DomainStartEndE-ValueType
low complexity region 5 26 N/A INTRINSIC
EGF 37 72 2.48e1 SMART
low complexity region 172 185 N/A INTRINSIC
low complexity region 200 214 N/A INTRINSIC
Pfam:An_peroxidase 221 528 1.5e-46 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133777
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149930
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202733
Meta Mutation Damage Score 0.7377 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.2%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: This is one of two genes encoding similar enzymes that catalyze the conversion of arachinodate to prostaglandin. The encoded protein regulates angiogenesis in endothelial cells, and is inhibited by nonsteroidal anti-inflammatory drugs such as aspirin. Based on its ability to function as both a cyclooxygenase and as a peroxidase, the encoded protein has been identified as a moonlighting protein. [provided by RefSeq, Jan 2014]
PHENOTYPE: Null mutants show impaired platelet aggregation, reduced inflammatory responses, and diminished susceptibility to induced papillomas. Female mutants exhibit delayed parturition and their offspring die neonatally. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik A G 12: 71,193,310 H1298R possibly damaging Het
5530400C23Rik T C 6: 133,294,458 L155P probably benign Het
6820408C15Rik A T 2: 152,441,266 R283S probably benign Het
Aldh1l2 T A 10: 83,518,678 E104D probably benign Het
Anxa3 T C 5: 96,811,099 V22A probably benign Het
Bcl7b T C 5: 135,180,883 F188L probably benign Het
Brinp1 T A 4: 68,762,776 I506F probably damaging Het
Bsdc1 T C 4: 129,461,718 probably benign Het
Ccdc180 T C 4: 45,923,271 I1075T possibly damaging Het
Cep162 A G 9: 87,193,697 L1294P probably damaging Het
Cltc G A 11: 86,704,626 probably benign Het
Col11a1 T C 3: 114,217,058 probably benign Het
Col14a1 A T 15: 55,388,646 Y566F unknown Het
Dhx29 A G 13: 112,963,277 Q1148R probably benign Het
Ehbp1 A G 11: 22,169,184 probably benign Het
Ehd3 A G 17: 73,805,379 H46R probably damaging Het
Fam171a1 T C 2: 3,225,396 V522A probably benign Het
Gm4553 C A 7: 142,165,625 C22F unknown Het
Hibadh C T 6: 52,557,770 probably benign Het
Hspg2 G A 4: 137,533,529 C1613Y probably damaging Het
Hydin G T 8: 110,413,223 C708F possibly damaging Het
Ifi208 A T 1: 173,683,481 M401L probably benign Het
Igsf8 G A 1: 172,318,796 V454M probably damaging Het
Irx4 G T 13: 73,266,720 probably benign Het
Kcnh4 C T 11: 100,746,932 G633E probably benign Het
Kcnn2 C T 18: 45,559,471 T38M possibly damaging Het
L3mbtl3 C T 10: 26,327,732 R400H unknown Het
Lrp6 T C 6: 134,485,661 T679A possibly damaging Het
Map9 T C 3: 82,374,203 probably null Het
Men1 T A 19: 6,336,923 V5E probably null Het
Mettl14 T C 3: 123,371,412 D93G probably damaging Het
Neb G T 2: 52,211,556 R4601S probably damaging Het
Nell1 A G 7: 50,228,846 T272A probably damaging Het
Olfr1115 A T 2: 87,252,255 N106I probably benign Het
Olfr319 A T 11: 58,701,793 I31F probably damaging Het
Pclo C A 5: 14,677,288 probably benign Het
Pdia5 A G 16: 35,397,507 L502P probably damaging Het
Pkd1l3 C G 8: 109,623,649 D375E possibly damaging Het
Plxna4 C A 6: 32,215,246 C803F probably damaging Het
Pmfbp1 A G 8: 109,513,968 probably null Het
Pxdn G T 12: 29,994,486 G488W probably damaging Het
Safb C T 17: 56,606,025 R914C probably damaging Het
Sec31b T A 19: 44,518,508 probably benign Het
Shank3 G A 15: 89,549,275 V1333I probably benign Het
Slamf1 A G 1: 171,792,371 probably benign Het
Slc23a3 T A 1: 75,133,230 Q131L possibly damaging Het
Slc7a11 A G 3: 50,384,051 V303A probably damaging Het
Slc7a13 T A 4: 19,841,500 V449D probably benign Het
Srp68 A T 11: 116,248,764 I453K probably damaging Het
Steap3 A T 1: 120,234,300 V414D probably damaging Het
Tagln2 A G 1: 172,506,221 N131D probably benign Het
Tmem132d T C 5: 128,269,203 Y85C probably damaging Het
Vcam1 A T 3: 116,115,946 Y577* probably null Het
Vmn1r214 A G 13: 23,035,253 T306A probably benign Het
Zfyve1 A T 12: 83,555,274 probably benign Het
Zgrf1 T A 3: 127,562,041 N305K possibly damaging Het
Other mutations in Ptgs1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00225:Ptgs1 APN 2 36237219 missense probably damaging 1.00
IGL02345:Ptgs1 APN 2 36242971 missense probably null 0.93
IGL02952:Ptgs1 APN 2 36251241 missense probably benign 0.00
IGL03306:Ptgs1 APN 2 36237705 missense probably damaging 1.00
PIT4431001:Ptgs1 UTSW 2 36240680 missense probably damaging 1.00
R0638:Ptgs1 UTSW 2 36240856 splice site probably benign
R1563:Ptgs1 UTSW 2 36245202 missense possibly damaging 0.53
R1858:Ptgs1 UTSW 2 36242770 missense probably benign 0.19
R2012:Ptgs1 UTSW 2 36237656 missense probably benign
R2080:Ptgs1 UTSW 2 36242847 nonsense probably null
R2116:Ptgs1 UTSW 2 36237696 nonsense probably null
R4073:Ptgs1 UTSW 2 36237776 missense probably damaging 1.00
R4163:Ptgs1 UTSW 2 36251334 missense possibly damaging 0.87
R4862:Ptgs1 UTSW 2 36237255 missense probably damaging 1.00
R5062:Ptgs1 UTSW 2 36237282 missense probably damaging 1.00
R5071:Ptgs1 UTSW 2 36251260 missense probably damaging 1.00
R5072:Ptgs1 UTSW 2 36251260 missense probably damaging 1.00
R5073:Ptgs1 UTSW 2 36251260 missense probably damaging 1.00
R5074:Ptgs1 UTSW 2 36251260 missense probably damaging 1.00
R5373:Ptgs1 UTSW 2 36251186 missense probably damaging 1.00
R5374:Ptgs1 UTSW 2 36251186 missense probably damaging 1.00
R5419:Ptgs1 UTSW 2 36237222 missense probably damaging 1.00
R5428:Ptgs1 UTSW 2 36245268 missense probably benign 0.00
R5918:Ptgs1 UTSW 2 36251077 missense probably damaging 1.00
R6134:Ptgs1 UTSW 2 36251178 missense probably damaging 1.00
R6181:Ptgs1 UTSW 2 36251119 missense probably damaging 1.00
R6240:Ptgs1 UTSW 2 36237285 missense probably damaging 1.00
R6979:Ptgs1 UTSW 2 36251299 missense probably benign
R7020:Ptgs1 UTSW 2 36251029 missense probably damaging 1.00
R7445:Ptgs1 UTSW 2 36245210 missense probably benign 0.06
R7557:Ptgs1 UTSW 2 36245211 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- GACCTTCCGCAGGACAGTAAAAGAG -3'
(R):5'- TTTGCCATACCTGAAGTGCCCC -3'

Sequencing Primer
(F):5'- AGTTTGACCTGATTCTGAGACTGAC -3'
(R):5'- CACCTGGAAAGTGGTGTCTCTC -3'
Posted On2013-05-23