Incidental Mutation 'R0468:Olfr1115'
ID41729
Institutional Source Beutler Lab
Gene Symbol Olfr1115
Ensembl Gene ENSMUSG00000070856
Gene Nameolfactory receptor 1115
SynonymsMOR264-20, MOR273-4P, MOR273-4P, Olfr1530-ps1, GA_x6K02T2Q125-48736906-48737886
MMRRC Submission 038668-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.095) question?
Stock #R0468 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location87248013-87253868 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 87252255 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 106 (N106I)
Ref Sequence ENSEMBL: ENSMUSP00000150996 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081986] [ENSMUST00000213513] [ENSMUST00000214119] [ENSMUST00000217196]
Predicted Effect probably benign
Transcript: ENSMUST00000081986
AA Change: N106I

PolyPhen 2 Score 0.038 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000080647
Gene: ENSMUSG00000070856
AA Change: N106I

DomainStartEndE-ValueType
Pfam:7tm_4 46 323 5e-54 PFAM
Pfam:7tm_1 56 305 3e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183480
Predicted Effect probably benign
Transcript: ENSMUST00000213513
AA Change: N106I

PolyPhen 2 Score 0.038 (Sensitivity: 0.94; Specificity: 0.82)
Predicted Effect probably benign
Transcript: ENSMUST00000214119
AA Change: N106I

PolyPhen 2 Score 0.038 (Sensitivity: 0.94; Specificity: 0.82)
Predicted Effect probably benign
Transcript: ENSMUST00000217196
AA Change: N106I

PolyPhen 2 Score 0.038 (Sensitivity: 0.94; Specificity: 0.82)
Meta Mutation Damage Score 0.5451 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.2%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik A G 12: 71,193,310 H1298R possibly damaging Het
5530400C23Rik T C 6: 133,294,458 L155P probably benign Het
6820408C15Rik A T 2: 152,441,266 R283S probably benign Het
Aldh1l2 T A 10: 83,518,678 E104D probably benign Het
Anxa3 T C 5: 96,811,099 V22A probably benign Het
Bcl7b T C 5: 135,180,883 F188L probably benign Het
Brinp1 T A 4: 68,762,776 I506F probably damaging Het
Bsdc1 T C 4: 129,461,718 probably benign Het
Ccdc180 T C 4: 45,923,271 I1075T possibly damaging Het
Cep162 A G 9: 87,193,697 L1294P probably damaging Het
Cltc G A 11: 86,704,626 probably benign Het
Col11a1 T C 3: 114,217,058 probably benign Het
Col14a1 A T 15: 55,388,646 Y566F unknown Het
Dhx29 A G 13: 112,963,277 Q1148R probably benign Het
Ehbp1 A G 11: 22,169,184 probably benign Het
Ehd3 A G 17: 73,805,379 H46R probably damaging Het
Fam171a1 T C 2: 3,225,396 V522A probably benign Het
Gm4553 C A 7: 142,165,625 C22F unknown Het
Hibadh C T 6: 52,557,770 probably benign Het
Hspg2 G A 4: 137,533,529 C1613Y probably damaging Het
Hydin G T 8: 110,413,223 C708F possibly damaging Het
Ifi208 A T 1: 173,683,481 M401L probably benign Het
Igsf8 G A 1: 172,318,796 V454M probably damaging Het
Irx4 G T 13: 73,266,720 probably benign Het
Kcnh4 C T 11: 100,746,932 G633E probably benign Het
Kcnn2 C T 18: 45,559,471 T38M possibly damaging Het
L3mbtl3 C T 10: 26,327,732 R400H unknown Het
Lrp6 T C 6: 134,485,661 T679A possibly damaging Het
Map9 T C 3: 82,374,203 probably null Het
Men1 T A 19: 6,336,923 V5E probably null Het
Mettl14 T C 3: 123,371,412 D93G probably damaging Het
Neb G T 2: 52,211,556 R4601S probably damaging Het
Nell1 A G 7: 50,228,846 T272A probably damaging Het
Olfr319 A T 11: 58,701,793 I31F probably damaging Het
Pclo C A 5: 14,677,288 probably benign Het
Pdia5 A G 16: 35,397,507 L502P probably damaging Het
Pkd1l3 C G 8: 109,623,649 D375E possibly damaging Het
Plxna4 C A 6: 32,215,246 C803F probably damaging Het
Pmfbp1 A G 8: 109,513,968 probably null Het
Ptgs1 A G 2: 36,249,193 Y468C probably damaging Het
Pxdn G T 12: 29,994,486 G488W probably damaging Het
Safb C T 17: 56,606,025 R914C probably damaging Het
Sec31b T A 19: 44,518,508 probably benign Het
Shank3 G A 15: 89,549,275 V1333I probably benign Het
Slamf1 A G 1: 171,792,371 probably benign Het
Slc23a3 T A 1: 75,133,230 Q131L possibly damaging Het
Slc7a11 A G 3: 50,384,051 V303A probably damaging Het
Slc7a13 T A 4: 19,841,500 V449D probably benign Het
Srp68 A T 11: 116,248,764 I453K probably damaging Het
Steap3 A T 1: 120,234,300 V414D probably damaging Het
Tagln2 A G 1: 172,506,221 N131D probably benign Het
Tmem132d T C 5: 128,269,203 Y85C probably damaging Het
Vcam1 A T 3: 116,115,946 Y577* probably null Het
Vmn1r214 A G 13: 23,035,253 T306A probably benign Het
Zfyve1 A T 12: 83,555,274 probably benign Het
Zgrf1 T A 3: 127,562,041 N305K possibly damaging Het
Other mutations in Olfr1115
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01101:Olfr1115 APN 2 87252462 missense probably damaging 1.00
IGL01376:Olfr1115 APN 2 87252873 missense possibly damaging 0.58
IGL02167:Olfr1115 APN 2 87252198 missense probably benign 0.18
IGL02224:Olfr1115 APN 2 87252477 missense probably benign 0.42
IGL02388:Olfr1115 APN 2 87251951 missense probably benign
IGL02596:Olfr1115 APN 2 87252129 missense probably damaging 0.98
PIT4131001:Olfr1115 UTSW 2 87252629 missense probably benign 0.01
R0140:Olfr1115 UTSW 2 87252625 missense probably damaging 1.00
R1222:Olfr1115 UTSW 2 87252422 missense probably benign 0.04
R1418:Olfr1115 UTSW 2 87252422 missense probably benign 0.04
R1742:Olfr1115 UTSW 2 87252778 missense probably benign 0.01
R1822:Olfr1115 UTSW 2 87252710 missense possibly damaging 0.91
R2332:Olfr1115 UTSW 2 87252873 missense possibly damaging 0.58
R3123:Olfr1115 UTSW 2 87252791 missense possibly damaging 0.67
R3407:Olfr1115 UTSW 2 87252899 missense probably benign 0.00
R4571:Olfr1115 UTSW 2 87252458 missense possibly damaging 0.67
R4710:Olfr1115 UTSW 2 87252040 missense possibly damaging 0.64
R4889:Olfr1115 UTSW 2 87252647 missense probably damaging 0.97
R5031:Olfr1115 UTSW 2 87252082 missense probably benign
R5288:Olfr1115 UTSW 2 87252483 missense probably benign 0.06
R5385:Olfr1115 UTSW 2 87252483 missense probably benign 0.06
R5386:Olfr1115 UTSW 2 87252483 missense probably benign 0.06
R5669:Olfr1115 UTSW 2 87252441 missense probably benign 0.00
R6187:Olfr1115 UTSW 2 87252698 missense probably damaging 1.00
R6226:Olfr1115 UTSW 2 87252392 missense probably benign 0.27
R6598:Olfr1115 UTSW 2 87252756 missense probably damaging 0.96
R8208:Olfr1115 UTSW 2 87252663 missense probably benign 0.24
Predicted Primers PCR Primer
(F):5'- CTTCTAGTTCCAGAGACATCACGCAG -3'
(R):5'- TGAATGGGAACACCAATGACCCAG -3'

Sequencing Primer
(F):5'- GATATTCCCCAATTGCACTGG -3'
(R):5'- GGAACCAACCACTAACTGGG -3'
Posted On2013-05-23