Incidental Mutation 'R0468:Slc7a13'
ID41736
Institutional Source Beutler Lab
Gene Symbol Slc7a13
Ensembl Gene ENSMUSG00000041052
Gene Namesolute carrier family 7, (cationic amino acid transporter, y+ system) member 13
SynonymsAGT1, XAT2, AGT-1, 0610009O04Rik
MMRRC Submission 038668-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0468 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location19818725-19842218 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 19841500 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 449 (V449D)
Ref Sequence ENSEMBL: ENSMUSP00000036228 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035890]
Predicted Effect probably benign
Transcript: ENSMUST00000035890
AA Change: V449D

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000036228
Gene: ENSMUSG00000041052
AA Change: V449D

DomainStartEndE-ValueType
Pfam:AA_permease_2 17 440 3.3e-44 PFAM
Pfam:AA_permease 21 454 3.7e-19 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.2%
Validation Efficiency 100% (61/61)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik A G 12: 71,193,310 H1298R possibly damaging Het
5530400C23Rik T C 6: 133,294,458 L155P probably benign Het
6820408C15Rik A T 2: 152,441,266 R283S probably benign Het
Aldh1l2 T A 10: 83,518,678 E104D probably benign Het
Anxa3 T C 5: 96,811,099 V22A probably benign Het
Bcl7b T C 5: 135,180,883 F188L probably benign Het
Brinp1 T A 4: 68,762,776 I506F probably damaging Het
Bsdc1 T C 4: 129,461,718 probably benign Het
Ccdc180 T C 4: 45,923,271 I1075T possibly damaging Het
Cep162 A G 9: 87,193,697 L1294P probably damaging Het
Cltc G A 11: 86,704,626 probably benign Het
Col11a1 T C 3: 114,217,058 probably benign Het
Col14a1 A T 15: 55,388,646 Y566F unknown Het
Dhx29 A G 13: 112,963,277 Q1148R probably benign Het
Ehbp1 A G 11: 22,169,184 probably benign Het
Ehd3 A G 17: 73,805,379 H46R probably damaging Het
Fam171a1 T C 2: 3,225,396 V522A probably benign Het
Gm4553 C A 7: 142,165,625 C22F unknown Het
Hibadh C T 6: 52,557,770 probably benign Het
Hspg2 G A 4: 137,533,529 C1613Y probably damaging Het
Hydin G T 8: 110,413,223 C708F possibly damaging Het
Ifi208 A T 1: 173,683,481 M401L probably benign Het
Igsf8 G A 1: 172,318,796 V454M probably damaging Het
Irx4 G T 13: 73,266,720 probably benign Het
Kcnh4 C T 11: 100,746,932 G633E probably benign Het
Kcnn2 C T 18: 45,559,471 T38M possibly damaging Het
L3mbtl3 C T 10: 26,327,732 R400H unknown Het
Lrp6 T C 6: 134,485,661 T679A possibly damaging Het
Map9 T C 3: 82,374,203 probably null Het
Men1 T A 19: 6,336,923 V5E probably null Het
Mettl14 T C 3: 123,371,412 D93G probably damaging Het
Neb G T 2: 52,211,556 R4601S probably damaging Het
Nell1 A G 7: 50,228,846 T272A probably damaging Het
Olfr1115 A T 2: 87,252,255 N106I probably benign Het
Olfr319 A T 11: 58,701,793 I31F probably damaging Het
Pclo C A 5: 14,677,288 probably benign Het
Pdia5 A G 16: 35,397,507 L502P probably damaging Het
Pkd1l3 C G 8: 109,623,649 D375E possibly damaging Het
Plxna4 C A 6: 32,215,246 C803F probably damaging Het
Pmfbp1 A G 8: 109,513,968 probably null Het
Ptgs1 A G 2: 36,249,193 Y468C probably damaging Het
Pxdn G T 12: 29,994,486 G488W probably damaging Het
Safb C T 17: 56,606,025 R914C probably damaging Het
Sec31b T A 19: 44,518,508 probably benign Het
Shank3 G A 15: 89,549,275 V1333I probably benign Het
Slamf1 A G 1: 171,792,371 probably benign Het
Slc23a3 T A 1: 75,133,230 Q131L possibly damaging Het
Slc7a11 A G 3: 50,384,051 V303A probably damaging Het
Srp68 A T 11: 116,248,764 I453K probably damaging Het
Steap3 A T 1: 120,234,300 V414D probably damaging Het
Tagln2 A G 1: 172,506,221 N131D probably benign Het
Tmem132d T C 5: 128,269,203 Y85C probably damaging Het
Vcam1 A T 3: 116,115,946 Y577* probably null Het
Vmn1r214 A G 13: 23,035,253 T306A probably benign Het
Zfyve1 A T 12: 83,555,274 probably benign Het
Zgrf1 T A 3: 127,562,041 N305K possibly damaging Het
Other mutations in Slc7a13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01769:Slc7a13 APN 4 19839527 missense probably benign 0.00
IGL02491:Slc7a13 APN 4 19841404 missense probably damaging 0.98
IGL02541:Slc7a13 APN 4 19839212 splice site probably benign
IGL02814:Slc7a13 APN 4 19839387 missense probably benign
R0145:Slc7a13 UTSW 4 19818782 start gained probably benign
R0305:Slc7a13 UTSW 4 19839401 missense probably benign 0.12
R0522:Slc7a13 UTSW 4 19824010 missense probably benign 0.02
R0848:Slc7a13 UTSW 4 19818866 missense probably benign 0.00
R1240:Slc7a13 UTSW 4 19819212 missense probably damaging 1.00
R1623:Slc7a13 UTSW 4 19824031 missense possibly damaging 0.84
R1830:Slc7a13 UTSW 4 19819046 missense probably benign 0.33
R1903:Slc7a13 UTSW 4 19839254 missense probably benign 0.01
R1952:Slc7a13 UTSW 4 19841578 missense probably benign
R2229:Slc7a13 UTSW 4 19839399 missense probably benign 0.43
R2887:Slc7a13 UTSW 4 19819052 missense possibly damaging 0.69
R4175:Slc7a13 UTSW 4 19819492 missense probably null 0.99
R4233:Slc7a13 UTSW 4 19819070 missense probably damaging 0.97
R4764:Slc7a13 UTSW 4 19819390 missense probably benign 0.08
R4941:Slc7a13 UTSW 4 19841467 missense probably damaging 1.00
R5355:Slc7a13 UTSW 4 19839267 missense probably benign 0.43
R6221:Slc7a13 UTSW 4 19839305 missense probably benign 0.00
R6641:Slc7a13 UTSW 4 19839534 missense probably damaging 1.00
R7237:Slc7a13 UTSW 4 19839364 missense probably benign
R8188:Slc7a13 UTSW 4 19819082 missense probably benign 0.03
R8384:Slc7a13 UTSW 4 19823984 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAATCAGCACCTTCTCTGAGAAATCTCC -3'
(R):5'- cagtcatctacccagccATTTCCTTTG -3'

Sequencing Primer
(F):5'- AAAGCTGACGTAGTCTGCTC -3'
(R):5'- ACCATTTCAGTTTATAGCATTGCC -3'
Posted On2013-05-23