Incidental Mutation 'R0468:Brinp1'
ID41738
Institutional Source Beutler Lab
Gene Symbol Brinp1
Ensembl Gene ENSMUSG00000028351
Gene Namebone morphogenic protein/retinoic acid inducible neural specific 1
SynonymsDbc1, Dbccr1, Fam5a
MMRRC Submission 038668-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.101) question?
Stock #R0468 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location68761514-68954397 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 68762776 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 506 (I506F)
Ref Sequence ENSEMBL: ENSMUSP00000030036 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030036]
Predicted Effect probably damaging
Transcript: ENSMUST00000030036
AA Change: I506F

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000030036
Gene: ENSMUSG00000028351
AA Change: I506F

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
MACPF 72 251 2.35e-46 SMART
Meta Mutation Damage Score 0.1385 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.2%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is located within a chromosomal region that shows loss of heterozygosity in some bladder cancers. It contains a 5' CpG island that may be a frequent target of hypermethylation, and it may undergo hypermethylation-based silencing in some bladder cancers. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice show increased adult neurogenesis in the subgranular zone of the dentate gyrus, altered neuronal differentiation in the hippocampus, and behavioral anomalies such as hyperactivity, reduced anxiety-like behaviors, poor social interaction, and a slight deficit in working memory. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik A G 12: 71,193,310 H1298R possibly damaging Het
5530400C23Rik T C 6: 133,294,458 L155P probably benign Het
6820408C15Rik A T 2: 152,441,266 R283S probably benign Het
Aldh1l2 T A 10: 83,518,678 E104D probably benign Het
Anxa3 T C 5: 96,811,099 V22A probably benign Het
Bcl7b T C 5: 135,180,883 F188L probably benign Het
Bsdc1 T C 4: 129,461,718 probably benign Het
Ccdc180 T C 4: 45,923,271 I1075T possibly damaging Het
Cep162 A G 9: 87,193,697 L1294P probably damaging Het
Cltc G A 11: 86,704,626 probably benign Het
Col11a1 T C 3: 114,217,058 probably benign Het
Col14a1 A T 15: 55,388,646 Y566F unknown Het
Dhx29 A G 13: 112,963,277 Q1148R probably benign Het
Ehbp1 A G 11: 22,169,184 probably benign Het
Ehd3 A G 17: 73,805,379 H46R probably damaging Het
Fam171a1 T C 2: 3,225,396 V522A probably benign Het
Gm4553 C A 7: 142,165,625 C22F unknown Het
Hibadh C T 6: 52,557,770 probably benign Het
Hspg2 G A 4: 137,533,529 C1613Y probably damaging Het
Hydin G T 8: 110,413,223 C708F possibly damaging Het
Ifi208 A T 1: 173,683,481 M401L probably benign Het
Igsf8 G A 1: 172,318,796 V454M probably damaging Het
Irx4 G T 13: 73,266,720 probably benign Het
Kcnh4 C T 11: 100,746,932 G633E probably benign Het
Kcnn2 C T 18: 45,559,471 T38M possibly damaging Het
L3mbtl3 C T 10: 26,327,732 R400H unknown Het
Lrp6 T C 6: 134,485,661 T679A possibly damaging Het
Map9 T C 3: 82,374,203 probably null Het
Men1 T A 19: 6,336,923 V5E probably null Het
Mettl14 T C 3: 123,371,412 D93G probably damaging Het
Neb G T 2: 52,211,556 R4601S probably damaging Het
Nell1 A G 7: 50,228,846 T272A probably damaging Het
Olfr1115 A T 2: 87,252,255 N106I probably benign Het
Olfr319 A T 11: 58,701,793 I31F probably damaging Het
Pclo C A 5: 14,677,288 probably benign Het
Pdia5 A G 16: 35,397,507 L502P probably damaging Het
Pkd1l3 C G 8: 109,623,649 D375E possibly damaging Het
Plxna4 C A 6: 32,215,246 C803F probably damaging Het
Pmfbp1 A G 8: 109,513,968 probably null Het
Ptgs1 A G 2: 36,249,193 Y468C probably damaging Het
Pxdn G T 12: 29,994,486 G488W probably damaging Het
Safb C T 17: 56,606,025 R914C probably damaging Het
Sec31b T A 19: 44,518,508 probably benign Het
Shank3 G A 15: 89,549,275 V1333I probably benign Het
Slamf1 A G 1: 171,792,371 probably benign Het
Slc23a3 T A 1: 75,133,230 Q131L possibly damaging Het
Slc7a11 A G 3: 50,384,051 V303A probably damaging Het
Slc7a13 T A 4: 19,841,500 V449D probably benign Het
Srp68 A T 11: 116,248,764 I453K probably damaging Het
Steap3 A T 1: 120,234,300 V414D probably damaging Het
Tagln2 A G 1: 172,506,221 N131D probably benign Het
Tmem132d T C 5: 128,269,203 Y85C probably damaging Het
Vcam1 A T 3: 116,115,946 Y577* probably null Het
Vmn1r214 A G 13: 23,035,253 T306A probably benign Het
Zfyve1 A T 12: 83,555,274 probably benign Het
Zgrf1 T A 3: 127,562,041 N305K possibly damaging Het
Other mutations in Brinp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00818:Brinp1 APN 4 68762847 missense probably damaging 1.00
IGL01024:Brinp1 APN 4 68762494 missense probably damaging 1.00
IGL02048:Brinp1 APN 4 68763142 missense probably benign
IGL02115:Brinp1 APN 4 68762398 missense probably benign 0.03
IGL02332:Brinp1 APN 4 68904884 missense probably benign 0.00
IGL03115:Brinp1 APN 4 68904736 critical splice donor site probably null
IGL02796:Brinp1 UTSW 4 68762190 missense probably damaging 1.00
R0382:Brinp1 UTSW 4 68762308 missense possibly damaging 0.68
R1141:Brinp1 UTSW 4 68792978 missense probably benign 0.00
R1164:Brinp1 UTSW 4 68798691 missense probably benign
R1178:Brinp1 UTSW 4 68762553 missense probably damaging 1.00
R1545:Brinp1 UTSW 4 68762955 missense possibly damaging 0.67
R1672:Brinp1 UTSW 4 68829283 splice site probably null
R1998:Brinp1 UTSW 4 68762553 missense probably damaging 1.00
R2218:Brinp1 UTSW 4 68762715 missense probably damaging 1.00
R2262:Brinp1 UTSW 4 68829354 missense probably damaging 1.00
R2370:Brinp1 UTSW 4 68762947 missense probably damaging 1.00
R4542:Brinp1 UTSW 4 68762092 missense probably benign 0.00
R4617:Brinp1 UTSW 4 68762961 missense possibly damaging 0.94
R4864:Brinp1 UTSW 4 68798886 missense probably damaging 1.00
R5287:Brinp1 UTSW 4 68792964 missense probably benign 0.04
R5403:Brinp1 UTSW 4 68792964 missense probably benign 0.04
R5932:Brinp1 UTSW 4 68792941 missense probably benign 0.00
R7106:Brinp1 UTSW 4 68829378 missense probably benign 0.36
R7127:Brinp1 UTSW 4 68793023 missense probably benign 0.00
R7398:Brinp1 UTSW 4 68841354 missense probably benign
R7917:Brinp1 UTSW 4 68904953 start codon destroyed probably null 0.04
R8164:Brinp1 UTSW 4 68762921 nonsense probably null
R8369:Brinp1 UTSW 4 68798699 missense possibly damaging 0.86
Z1176:Brinp1 UTSW 4 68798751 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CGAGGGTAGCCAAATTCCCCAAAG -3'
(R):5'- CTCACTCTGTGGCTCCTGCAATAAG -3'

Sequencing Primer
(F):5'- TCTGAATGGCTCCCACTGAAG -3'
(R):5'- GCTCCTGCAATAAGGGCTAC -3'
Posted On2013-05-23