Mutagenetix > Incidental Mutation

Incidental Mutation 'R0468:L3mbtl3'

41755

Institutional Source

Beutler Lab

Gene Symbol

L3mbtl3

Ensembl Gene

ENSMUSG00000039089

Gene Name

L3MBTL3 histone methyl-lysine binding protein

Synonyms

MBT-1

MMRRC Submission

038668-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R0468 (G1)

Quality Score

223

Status

Validated

Chromosome

Chromosomal Location

26274468-26375971 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 26327732 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Histidine at position 400 (R400H)

Ref Sequence

ENSEMBL: ENSMUSP00000133479 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000040219] [ENSMUST00000105519] [ENSMUST00000174766]

AlphaFold

Q8BLB7

Predicted Effect

unknown
Transcript: ENSMUST00000040219
AA Change: R400H

SMART Domains

Protein: ENSMUSP00000037619
Gene: ENSMUSG00000039089
AA Change: R400H

Domain	Start	End	E-Value	Type
low complexity region	154	166	N/A	INTRINSIC
low complexity region	204	214	N/A	INTRINSIC
MBT	232	332	3.75e-48	SMART
MBT	340	439	3.67e-42	SMART
MBT	448	543	7.5e-48	SMART
low complexity region	604	615	N/A	INTRINSIC
low complexity region	662	770	N/A	INTRINSIC
SAM	808	875	2.49e-13	SMART

Predicted Effect

unknown
Transcript: ENSMUST00000105519
AA Change: R375H

SMART Domains

Protein: ENSMUSP00000101158
Gene: ENSMUSG00000039089
AA Change: R375H

Domain	Start	End	E-Value	Type
low complexity region	129	141	N/A	INTRINSIC
low complexity region	179	189	N/A	INTRINSIC
MBT	207	307	3.75e-48	SMART
MBT	315	414	3.67e-42	SMART
MBT	423	518	7.5e-48	SMART
low complexity region	579	590	N/A	INTRINSIC
low complexity region	637	745	N/A	INTRINSIC
SAM	783	850	2.49e-13	SMART

Predicted Effect

unknown
Transcript: ENSMUST00000174766
AA Change: R400H

SMART Domains

Protein: ENSMUSP00000133479
Gene: ENSMUSG00000039089
AA Change: R400H

Domain	Start	End	E-Value	Type
low complexity region	154	166	N/A	INTRINSIC
low complexity region	204	214	N/A	INTRINSIC
MBT	232	332	3.75e-48	SMART
MBT	340	439	3.67e-42	SMART
MBT	448	543	7.5e-48	SMART
low complexity region	604	615	N/A	INTRINSIC
low complexity region	662	770	N/A	INTRINSIC
SAM	808	875	2.49e-13	SMART

Meta Mutation Damage Score

0.4655

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.8%
20x: 94.2%

Validation Efficiency

100% (61/61)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the malignant brain tumor (MBT) family of chromatin interacting transcriptional repressors. Members of this family function as methyl-lysine readers, which recognize methylated lysine residues on histone protein tails, and are associated with the repression of gene expression. The encoded protein may regulate hematopoiesis. Homozygous deletion of this gene has been observed in human patients with medulloblastoma. [provided by RefSeq, Oct 2016]
PHENOTYPE: Mice homozygous for a null mutation die between E17.5 ? 19.5 due to disturbed erythropoiesis which result in anemia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2700049A03Rik	A	G	12: 71,193,310	H1298R	possibly damaging	Het
5530400C23Rik	T	C	6: 133,294,458	L155P	probably benign	Het
6820408C15Rik	A	T	2: 152,441,266	R283S	probably benign	Het
Aldh1l2	T	A	10: 83,518,678	E104D	probably benign	Het
Anxa3	T	C	5: 96,811,099	V22A	probably benign	Het
Bcl7b	T	C	5: 135,180,883	F188L	probably benign	Het
Brinp1	T	A	4: 68,762,776	I506F	probably damaging	Het
Bsdc1	T	C	4: 129,461,718		probably benign	Het
Ccdc180	T	C	4: 45,923,271	I1075T	possibly damaging	Het
Cep162	A	G	9: 87,193,697	L1294P	probably damaging	Het
Cltc	G	A	11: 86,704,626		probably benign	Het
Col11a1	T	C	3: 114,217,058		probably benign	Het
Col14a1	A	T	15: 55,388,646	Y566F	unknown	Het
Dhx29	A	G	13: 112,963,277	Q1148R	probably benign	Het
Ehbp1	A	G	11: 22,169,184		probably benign	Het
Ehd3	A	G	17: 73,805,379	H46R	probably damaging	Het
Fam171a1	T	C	2: 3,225,396	V522A	probably benign	Het
Gm4553	C	A	7: 142,165,625	C22F	unknown	Het
Hibadh	C	T	6: 52,557,770		probably benign	Het
Hspg2	G	A	4: 137,533,529	C1613Y	probably damaging	Het
Hydin	G	T	8: 110,413,223	C708F	possibly damaging	Het
Ifi208	A	T	1: 173,683,481	M401L	probably benign	Het
Igsf8	G	A	1: 172,318,796	V454M	probably damaging	Het
Irx4	G	T	13: 73,266,720		probably benign	Het
Kcnh4	C	T	11: 100,746,932	G633E	probably benign	Het
Kcnn2	C	T	18: 45,559,471	T38M	possibly damaging	Het
Lrp6	T	C	6: 134,485,661	T679A	possibly damaging	Het
Map9	T	C	3: 82,374,203		probably null	Het
Men1	T	A	19: 6,336,923	V5E	probably null	Het
Mettl14	T	C	3: 123,371,412	D93G	probably damaging	Het
Neb	G	T	2: 52,211,556	R4601S	probably damaging	Het
Nell1	A	G	7: 50,228,846	T272A	probably damaging	Het
Olfr1115	A	T	2: 87,252,255	N106I	probably benign	Het
Olfr319	A	T	11: 58,701,793	I31F	probably damaging	Het
Pclo	C	A	5: 14,677,288		probably benign	Het
Pdia5	A	G	16: 35,397,507	L502P	probably damaging	Het
Pkd1l3	C	G	8: 109,623,649	D375E	possibly damaging	Het
Plxna4	C	A	6: 32,215,246	C803F	probably damaging	Het
Pmfbp1	A	G	8: 109,513,968		probably null	Het
Ptgs1	A	G	2: 36,249,193	Y468C	probably damaging	Het
Pxdn	G	T	12: 29,994,486	G488W	probably damaging	Het
Safb	C	T	17: 56,606,025	R914C	probably damaging	Het
Sec31b	T	A	19: 44,518,508		probably benign	Het
Shank3	G	A	15: 89,549,275	V1333I	probably benign	Het
Slamf1	A	G	1: 171,792,371		probably benign	Het
Slc23a3	T	A	1: 75,133,230	Q131L	possibly damaging	Het
Slc7a11	A	G	3: 50,384,051	V303A	probably damaging	Het
Slc7a13	T	A	4: 19,841,500	V449D	probably benign	Het
Srp68	A	T	11: 116,248,764	I453K	probably damaging	Het
Steap3	A	T	1: 120,234,300	V414D	probably damaging	Het
Tagln2	A	G	1: 172,506,221	N131D	probably benign	Het
Tmem132d	T	C	5: 128,269,203	Y85C	probably damaging	Het
Vcam1	A	T	3: 116,115,946	Y577*	probably null	Het
Vmn1r214	A	G	13: 23,035,253	T306A	probably benign	Het
Zfyve1	A	T	12: 83,555,274		probably benign	Het
Zgrf1	T	A	3: 127,562,041	N305K	possibly damaging	Het

Other mutations in L3mbtl3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00905:L3mbtl3	APN	10	26313846	critical splice donor site	probably null
IGL01357:L3mbtl3	APN	10	26330185	missense	unknown
IGL01712:L3mbtl3	APN	10	26276235	missense	probably damaging	0.96
IGL01759:L3mbtl3	APN	10	26331900	missense	unknown
IGL01928:L3mbtl3	APN	10	26330245	missense	unknown
IGL01955:L3mbtl3	APN	10	26318438	missense	unknown
IGL02674:L3mbtl3	APN	10	26282813	missense	unknown
IGL02731:L3mbtl3	APN	10	26344176	critical splice donor site	probably null
IGL03188:L3mbtl3	APN	10	26342617	missense	unknown
IGL03252:L3mbtl3	APN	10	26331812	splice site	probably benign
IGL03298:L3mbtl3	APN	10	26282798	missense	unknown
IGL03400:L3mbtl3	APN	10	26315526	missense	unknown
R0121:L3mbtl3	UTSW	10	26313870	missense	unknown
R0497:L3mbtl3	UTSW	10	26282874	splice site	probably benign
R0586:L3mbtl3	UTSW	10	26327834	missense	unknown
R0633:L3mbtl3	UTSW	10	26302685	missense	unknown
R0679:L3mbtl3	UTSW	10	26313933	nonsense	probably null
R1302:L3mbtl3	UTSW	10	26327769	missense	unknown
R2128:L3mbtl3	UTSW	10	26313868	missense	unknown
R2267:L3mbtl3	UTSW	10	26331857	nonsense	probably null
R3121:L3mbtl3	UTSW	10	26344221	intron	probably benign
R3410:L3mbtl3	UTSW	10	26339299	missense	unknown
R4237:L3mbtl3	UTSW	10	26340948	missense	unknown
R4257:L3mbtl3	UTSW	10	26280122	missense	unknown
R4308:L3mbtl3	UTSW	10	26282792	missense	unknown
R4359:L3mbtl3	UTSW	10	26327741	missense	unknown
R4407:L3mbtl3	UTSW	10	26313884	missense	unknown
R4613:L3mbtl3	UTSW	10	26282795	missense	unknown
R4663:L3mbtl3	UTSW	10	26337817	missense	unknown
R4843:L3mbtl3	UTSW	10	26331879	missense	unknown
R4886:L3mbtl3	UTSW	10	26292770	missense	unknown
R5158:L3mbtl3	UTSW	10	26303688	missense	unknown
R5247:L3mbtl3	UTSW	10	26327808	missense	unknown
R5580:L3mbtl3	UTSW	10	26303706	missense	unknown
R5966:L3mbtl3	UTSW	10	26331864	missense	unknown
R6218:L3mbtl3	UTSW	10	26292747	missense	unknown
R6508:L3mbtl3	UTSW	10	26318427	missense	unknown
R6563:L3mbtl3	UTSW	10	26302863	splice site	probably null
R6709:L3mbtl3	UTSW	10	26282797	missense	unknown
R6927:L3mbtl3	UTSW	10	26292669	nonsense	probably null
R6984:L3mbtl3	UTSW	10	26282855	missense	unknown
R7010:L3mbtl3	UTSW	10	26282861	critical splice acceptor site	probably null
R7229:L3mbtl3	UTSW	10	26292662	missense	unknown
R7231:L3mbtl3	UTSW	10	26339282	missense	unknown
R7296:L3mbtl3	UTSW	10	26282830	missense	unknown
R7363:L3mbtl3	UTSW	10	26340952	missense	unknown
R7490:L3mbtl3	UTSW	10	26339231	missense	unknown
R7775:L3mbtl3	UTSW	10	26352317	missense	unknown
R7815:L3mbtl3	UTSW	10	26280378	missense	unknown
R8272:L3mbtl3	UTSW	10	26303668	missense	unknown
R8762:L3mbtl3	UTSW	10	26276223	missense	probably damaging	1.00
R8925:L3mbtl3	UTSW	10	26344186	missense	unknown
R8927:L3mbtl3	UTSW	10	26344186	missense	unknown
R9043:L3mbtl3	UTSW	10	26280254	missense	unknown
R9228:L3mbtl3	UTSW	10	26336257	missense	unknown
Z1177:L3mbtl3	UTSW	10	26280402	nonsense	probably null
Z1177:L3mbtl3	UTSW	10	26302663	missense	unknown

Predicted Primers

PCR Primer
(F):5'- ACGTCAGTCATAGTTAGAACTTTTGGGC -3'
(R):5'- AGGTGACCTACTTTCTTGAGCGAGT -3'

Sequencing Primer
(F):5'- GAACTTTTGGGCTTCTTATGAACTTC -3'
(R):5'- AGCCATGTGTTGACTCAGAC -3'

Posted On

2013-05-23