Incidental Mutation 'R0468:Aldh1l2'
ID41756
Institutional Source Beutler Lab
Gene Symbol Aldh1l2
Ensembl Gene ENSMUSG00000020256
Gene Namealdehyde dehydrogenase 1 family, member L2
Synonyms
MMRRC Submission 038668-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0468 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location83487450-83534140 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 83518678 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 104 (E104D)
Ref Sequence ENSEMBL: ENSMUSP00000117076 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020497] [ENSMUST00000146640]
Predicted Effect probably benign
Transcript: ENSMUST00000020497
AA Change: E217D

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000020497
Gene: ENSMUSG00000020256
AA Change: E217D

DomainStartEndE-ValueType
Pfam:Formyl_trans_N 23 202 5e-46 PFAM
Pfam:Formyl_trans_C 226 330 1.3e-16 PFAM
Pfam:PP-binding 346 412 9.6e-7 PFAM
Pfam:Aldedh 451 919 3.4e-174 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125193
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138858
Predicted Effect probably benign
Transcript: ENSMUST00000146640
AA Change: E104D

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000117076
Gene: ENSMUSG00000020256
AA Change: E104D

DomainStartEndE-ValueType
Pfam:Formyl_trans_N 1 89 2.8e-30 PFAM
Pfam:Formyl_trans_C 113 217 1.1e-16 PFAM
Pfam:PP-binding 233 299 1.5e-8 PFAM
Pfam:Aldedh 338 806 8.5e-175 PFAM
Meta Mutation Damage Score 0.0746 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.2%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of both the aldehyde dehydrogenase superfamily and the formyl transferase superfamily. This member is the mitochondrial form of 10-formyltetrahydrofolate dehydrogenase (FDH), which converts 10-formyltetrahydrofolate to tetrahydrofolate and CO2 in an NADP(+)-dependent reaction, and plays an essential role in the distribution of one-carbon groups between the cytosolic and mitochondrial compartments of the cell. Alternatively spliced transcript variants have been found for this gene.[provided by RefSeq, Oct 2010]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik A G 12: 71,193,310 H1298R possibly damaging Het
5530400C23Rik T C 6: 133,294,458 L155P probably benign Het
6820408C15Rik A T 2: 152,441,266 R283S probably benign Het
Anxa3 T C 5: 96,811,099 V22A probably benign Het
Bcl7b T C 5: 135,180,883 F188L probably benign Het
Brinp1 T A 4: 68,762,776 I506F probably damaging Het
Bsdc1 T C 4: 129,461,718 probably benign Het
Ccdc180 T C 4: 45,923,271 I1075T possibly damaging Het
Cep162 A G 9: 87,193,697 L1294P probably damaging Het
Cltc G A 11: 86,704,626 probably benign Het
Col11a1 T C 3: 114,217,058 probably benign Het
Col14a1 A T 15: 55,388,646 Y566F unknown Het
Dhx29 A G 13: 112,963,277 Q1148R probably benign Het
Ehbp1 A G 11: 22,169,184 probably benign Het
Ehd3 A G 17: 73,805,379 H46R probably damaging Het
Fam171a1 T C 2: 3,225,396 V522A probably benign Het
Gm4553 C A 7: 142,165,625 C22F unknown Het
Hibadh C T 6: 52,557,770 probably benign Het
Hspg2 G A 4: 137,533,529 C1613Y probably damaging Het
Hydin G T 8: 110,413,223 C708F possibly damaging Het
Ifi208 A T 1: 173,683,481 M401L probably benign Het
Igsf8 G A 1: 172,318,796 V454M probably damaging Het
Irx4 G T 13: 73,266,720 probably benign Het
Kcnh4 C T 11: 100,746,932 G633E probably benign Het
Kcnn2 C T 18: 45,559,471 T38M possibly damaging Het
L3mbtl3 C T 10: 26,327,732 R400H unknown Het
Lrp6 T C 6: 134,485,661 T679A possibly damaging Het
Map9 T C 3: 82,374,203 probably null Het
Men1 T A 19: 6,336,923 V5E probably null Het
Mettl14 T C 3: 123,371,412 D93G probably damaging Het
Neb G T 2: 52,211,556 R4601S probably damaging Het
Nell1 A G 7: 50,228,846 T272A probably damaging Het
Olfr1115 A T 2: 87,252,255 N106I probably benign Het
Olfr319 A T 11: 58,701,793 I31F probably damaging Het
Pclo C A 5: 14,677,288 probably benign Het
Pdia5 A G 16: 35,397,507 L502P probably damaging Het
Pkd1l3 C G 8: 109,623,649 D375E possibly damaging Het
Plxna4 C A 6: 32,215,246 C803F probably damaging Het
Pmfbp1 A G 8: 109,513,968 probably null Het
Ptgs1 A G 2: 36,249,193 Y468C probably damaging Het
Pxdn G T 12: 29,994,486 G488W probably damaging Het
Safb C T 17: 56,606,025 R914C probably damaging Het
Sec31b T A 19: 44,518,508 probably benign Het
Shank3 G A 15: 89,549,275 V1333I probably benign Het
Slamf1 A G 1: 171,792,371 probably benign Het
Slc23a3 T A 1: 75,133,230 Q131L possibly damaging Het
Slc7a11 A G 3: 50,384,051 V303A probably damaging Het
Slc7a13 T A 4: 19,841,500 V449D probably benign Het
Srp68 A T 11: 116,248,764 I453K probably damaging Het
Steap3 A T 1: 120,234,300 V414D probably damaging Het
Tagln2 A G 1: 172,506,221 N131D probably benign Het
Tmem132d T C 5: 128,269,203 Y85C probably damaging Het
Vcam1 A T 3: 116,115,946 Y577* probably null Het
Vmn1r214 A G 13: 23,035,253 T306A probably benign Het
Zfyve1 A T 12: 83,555,274 probably benign Het
Zgrf1 T A 3: 127,562,041 N305K possibly damaging Het
Other mutations in Aldh1l2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01152:Aldh1l2 APN 10 83522886 nonsense probably null
IGL01154:Aldh1l2 APN 10 83520373 missense probably damaging 1.00
IGL01301:Aldh1l2 APN 10 83522846 missense probably damaging 1.00
IGL01354:Aldh1l2 APN 10 83527376 missense probably damaging 1.00
IGL01364:Aldh1l2 APN 10 83492667 missense probably damaging 1.00
IGL01445:Aldh1l2 APN 10 83520262 splice site probably benign
IGL02179:Aldh1l2 APN 10 83522837 missense probably benign 0.10
IGL02283:Aldh1l2 APN 10 83495895 missense probably benign 0.00
IGL02507:Aldh1l2 APN 10 83492584 nonsense probably null
IGL02727:Aldh1l2 APN 10 83506605 missense probably damaging 1.00
IGL03353:Aldh1l2 APN 10 83522913 missense probably benign 0.17
Hunger_winter UTSW 10 83508013 critical splice donor site probably null
Spartan UTSW 10 83512306 missense possibly damaging 0.93
ANU18:Aldh1l2 UTSW 10 83522846 missense probably damaging 1.00
IGL02984:Aldh1l2 UTSW 10 83527335 missense probably damaging 1.00
R0267:Aldh1l2 UTSW 10 83522687 splice site probably benign
R0302:Aldh1l2 UTSW 10 83520365 missense probably damaging 1.00
R0349:Aldh1l2 UTSW 10 83490614 missense probably damaging 1.00
R0745:Aldh1l2 UTSW 10 83518630 splice site probably null
R0788:Aldh1l2 UTSW 10 83516164 missense probably damaging 1.00
R1117:Aldh1l2 UTSW 10 83508623 missense probably benign 0.01
R1241:Aldh1l2 UTSW 10 83496025 missense probably benign 0.00
R1420:Aldh1l2 UTSW 10 83495935 missense probably damaging 1.00
R1490:Aldh1l2 UTSW 10 83520370 missense probably damaging 1.00
R1704:Aldh1l2 UTSW 10 83508660 missense probably benign 0.10
R1729:Aldh1l2 UTSW 10 83508082 nonsense probably null
R1893:Aldh1l2 UTSW 10 83492536 missense probably damaging 1.00
R1897:Aldh1l2 UTSW 10 83502525 missense probably damaging 1.00
R2047:Aldh1l2 UTSW 10 83506743 missense probably damaging 1.00
R2290:Aldh1l2 UTSW 10 83527313 missense probably damaging 1.00
R3054:Aldh1l2 UTSW 10 83502472 missense probably benign 0.14
R3055:Aldh1l2 UTSW 10 83502472 missense probably benign 0.14
R4097:Aldh1l2 UTSW 10 83512364 missense probably damaging 0.98
R4162:Aldh1l2 UTSW 10 83506654 missense possibly damaging 0.50
R4295:Aldh1l2 UTSW 10 83495920 missense possibly damaging 0.62
R4296:Aldh1l2 UTSW 10 83522777 missense probably benign 0.34
R4388:Aldh1l2 UTSW 10 83513622 missense probably damaging 1.00
R4809:Aldh1l2 UTSW 10 83506632 missense probably damaging 1.00
R5052:Aldh1l2 UTSW 10 83508692 missense possibly damaging 0.92
R5421:Aldh1l2 UTSW 10 83527407 missense probably damaging 1.00
R5491:Aldh1l2 UTSW 10 83522785 missense probably benign 0.00
R5688:Aldh1l2 UTSW 10 83501925 missense possibly damaging 0.93
R5726:Aldh1l2 UTSW 10 83512306 missense possibly damaging 0.93
R5737:Aldh1l2 UTSW 10 83520325 missense probably damaging 1.00
R5752:Aldh1l2 UTSW 10 83520380 missense probably damaging 1.00
R6113:Aldh1l2 UTSW 10 83508134 nonsense probably null
R6161:Aldh1l2 UTSW 10 83520338 missense probably benign 0.00
R6166:Aldh1l2 UTSW 10 83493424 splice site probably null
R6189:Aldh1l2 UTSW 10 83508013 critical splice donor site probably null
R7357:Aldh1l2 UTSW 10 83514544 missense possibly damaging 0.89
R7394:Aldh1l2 UTSW 10 83502457 missense probably damaging 1.00
R7469:Aldh1l2 UTSW 10 83508105 missense probably damaging 1.00
R7676:Aldh1l2 UTSW 10 83508111 missense probably benign
R7848:Aldh1l2 UTSW 10 83499843 missense probably benign 0.12
R7958:Aldh1l2 UTSW 10 83520338 missense probably benign 0.00
R8311:Aldh1l2 UTSW 10 83490615 missense probably damaging 1.00
Z1177:Aldh1l2 UTSW 10 83493480 missense probably damaging 1.00
Z1177:Aldh1l2 UTSW 10 83534005 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCTTCCATCGGGGAAACGAGTGAG -3'
(R):5'- TGTTGGAGTGGGCACACCAAAG -3'

Sequencing Primer
(F):5'- GGACACACGTAGGGCCAG -3'
(R):5'- gagttatgggggggggg -3'
Posted On2013-05-23