Incidental Mutation 'R0468:Ehbp1'
ID41757
Institutional Source Beutler Lab
Gene Symbol Ehbp1
Ensembl Gene ENSMUSG00000042302
Gene NameEH domain binding protein 1
SynonymsKIAA0903-like, Flj21950
MMRRC Submission 038668-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.499) question?
Stock #R0468 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location22005828-22342292 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 22169184 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000136697 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045167] [ENSMUST00000109563] [ENSMUST00000134293] [ENSMUST00000180360]
Predicted Effect probably benign
Transcript: ENSMUST00000045167
SMART Domains Protein: ENSMUSP00000037489
Gene: ENSMUSG00000042302

DomainStartEndE-ValueType
Pfam:NT-C2 12 165 3.8e-32 PFAM
Blast:DUF3585 176 285 7e-6 BLAST
low complexity region 332 343 N/A INTRINSIC
low complexity region 374 392 N/A INTRINSIC
low complexity region 411 422 N/A INTRINSIC
CH 430 528 1.42e-15 SMART
Blast:CH 757 826 3e-12 BLAST
low complexity region 829 850 N/A INTRINSIC
low complexity region 883 898 N/A INTRINSIC
DUF3585 1043 1187 4.25e-61 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109563
SMART Domains Protein: ENSMUSP00000105191
Gene: ENSMUSG00000042302

DomainStartEndE-ValueType
Pfam:NT-C2 12 165 1.3e-29 PFAM
Blast:DUF3585 176 285 7e-6 BLAST
low complexity region 357 368 N/A INTRINSIC
low complexity region 399 417 N/A INTRINSIC
low complexity region 436 447 N/A INTRINSIC
CH 455 553 1.42e-15 SMART
Blast:CH 782 851 3e-12 BLAST
low complexity region 854 875 N/A INTRINSIC
low complexity region 908 923 N/A INTRINSIC
DUF3585 1068 1212 4.25e-61 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000134293
SMART Domains Protein: ENSMUSP00000118583
Gene: ENSMUSG00000042302

DomainStartEndE-ValueType
Pfam:NT-C2 12 165 3.5e-33 PFAM
low complexity region 185 205 N/A INTRINSIC
Blast:DUF3585 206 250 4e-18 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136762
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152372
Predicted Effect probably benign
Transcript: ENSMUST00000180360
SMART Domains Protein: ENSMUSP00000136697
Gene: ENSMUSG00000042302

DomainStartEndE-ValueType
Pfam:NT-C2 12 165 3.8e-32 PFAM
Blast:DUF3585 176 285 7e-6 BLAST
low complexity region 332 343 N/A INTRINSIC
low complexity region 374 392 N/A INTRINSIC
low complexity region 411 422 N/A INTRINSIC
CH 430 528 1.42e-15 SMART
Blast:CH 757 826 3e-12 BLAST
low complexity region 829 850 N/A INTRINSIC
low complexity region 883 898 N/A INTRINSIC
DUF3585 1043 1187 4.25e-61 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.2%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an Eps15 homology domain binding protein. The encoded protein may play a role in endocytic trafficking. A single nucleotide polymorphism in this gene is associated with an aggressive form of prostate cancer. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Feb 2010]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik A G 12: 71,193,310 H1298R possibly damaging Het
5530400C23Rik T C 6: 133,294,458 L155P probably benign Het
6820408C15Rik A T 2: 152,441,266 R283S probably benign Het
Aldh1l2 T A 10: 83,518,678 E104D probably benign Het
Anxa3 T C 5: 96,811,099 V22A probably benign Het
Bcl7b T C 5: 135,180,883 F188L probably benign Het
Brinp1 T A 4: 68,762,776 I506F probably damaging Het
Bsdc1 T C 4: 129,461,718 probably benign Het
Ccdc180 T C 4: 45,923,271 I1075T possibly damaging Het
Cep162 A G 9: 87,193,697 L1294P probably damaging Het
Cltc G A 11: 86,704,626 probably benign Het
Col11a1 T C 3: 114,217,058 probably benign Het
Col14a1 A T 15: 55,388,646 Y566F unknown Het
Dhx29 A G 13: 112,963,277 Q1148R probably benign Het
Ehd3 A G 17: 73,805,379 H46R probably damaging Het
Fam171a1 T C 2: 3,225,396 V522A probably benign Het
Gm4553 C A 7: 142,165,625 C22F unknown Het
Hibadh C T 6: 52,557,770 probably benign Het
Hspg2 G A 4: 137,533,529 C1613Y probably damaging Het
Hydin G T 8: 110,413,223 C708F possibly damaging Het
Ifi208 A T 1: 173,683,481 M401L probably benign Het
Igsf8 G A 1: 172,318,796 V454M probably damaging Het
Irx4 G T 13: 73,266,720 probably benign Het
Kcnh4 C T 11: 100,746,932 G633E probably benign Het
Kcnn2 C T 18: 45,559,471 T38M possibly damaging Het
L3mbtl3 C T 10: 26,327,732 R400H unknown Het
Lrp6 T C 6: 134,485,661 T679A possibly damaging Het
Map9 T C 3: 82,374,203 probably null Het
Men1 T A 19: 6,336,923 V5E probably null Het
Mettl14 T C 3: 123,371,412 D93G probably damaging Het
Neb G T 2: 52,211,556 R4601S probably damaging Het
Nell1 A G 7: 50,228,846 T272A probably damaging Het
Olfr1115 A T 2: 87,252,255 N106I probably benign Het
Olfr319 A T 11: 58,701,793 I31F probably damaging Het
Pclo C A 5: 14,677,288 probably benign Het
Pdia5 A G 16: 35,397,507 L502P probably damaging Het
Pkd1l3 C G 8: 109,623,649 D375E possibly damaging Het
Plxna4 C A 6: 32,215,246 C803F probably damaging Het
Pmfbp1 A G 8: 109,513,968 probably null Het
Ptgs1 A G 2: 36,249,193 Y468C probably damaging Het
Pxdn G T 12: 29,994,486 G488W probably damaging Het
Safb C T 17: 56,606,025 R914C probably damaging Het
Sec31b T A 19: 44,518,508 probably benign Het
Shank3 G A 15: 89,549,275 V1333I probably benign Het
Slamf1 A G 1: 171,792,371 probably benign Het
Slc23a3 T A 1: 75,133,230 Q131L possibly damaging Het
Slc7a11 A G 3: 50,384,051 V303A probably damaging Het
Slc7a13 T A 4: 19,841,500 V449D probably benign Het
Srp68 A T 11: 116,248,764 I453K probably damaging Het
Steap3 A T 1: 120,234,300 V414D probably damaging Het
Tagln2 A G 1: 172,506,221 N131D probably benign Het
Tmem132d T C 5: 128,269,203 Y85C probably damaging Het
Vcam1 A T 3: 116,115,946 Y577* probably null Het
Vmn1r214 A G 13: 23,035,253 T306A probably benign Het
Zfyve1 A T 12: 83,555,274 probably benign Het
Zgrf1 T A 3: 127,562,041 N305K possibly damaging Het
Other mutations in Ehbp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00754:Ehbp1 APN 11 22247967 splice site probably benign
IGL00786:Ehbp1 APN 11 22100460 missense possibly damaging 0.79
IGL01308:Ehbp1 APN 11 22138022 missense probably damaging 1.00
IGL01322:Ehbp1 APN 11 22089636 missense probably damaging 1.00
IGL01590:Ehbp1 APN 11 22095611 missense possibly damaging 0.91
IGL01611:Ehbp1 APN 11 22172883 missense probably damaging 0.98
IGL01636:Ehbp1 APN 11 22089584 missense probably benign 0.03
IGL01728:Ehbp1 APN 11 22101115 missense probably damaging 1.00
IGL02012:Ehbp1 APN 11 22101218 missense probably damaging 1.00
IGL02034:Ehbp1 APN 11 22285486 critical splice donor site probably null
IGL02324:Ehbp1 APN 11 22096048 missense probably damaging 1.00
IGL02511:Ehbp1 APN 11 22089653 missense probably damaging 1.00
trajan UTSW 11 22151850 missense probably damaging 1.00
K7894:Ehbp1 UTSW 11 22089683 splice site probably benign
PIT4418001:Ehbp1 UTSW 11 22053494 missense probably damaging 1.00
R0218:Ehbp1 UTSW 11 22231992 splice site probably benign
R0294:Ehbp1 UTSW 11 22095427 missense probably benign 0.27
R0398:Ehbp1 UTSW 11 22095886 missense probably damaging 0.99
R0420:Ehbp1 UTSW 11 22151836 missense probably benign
R0943:Ehbp1 UTSW 11 22095883 missense probably benign 0.12
R1181:Ehbp1 UTSW 11 22062831 missense probably benign 0.25
R1481:Ehbp1 UTSW 11 22006782 makesense probably null
R1493:Ehbp1 UTSW 11 22006866 missense probably damaging 1.00
R1563:Ehbp1 UTSW 11 22059231 missense probably damaging 1.00
R1648:Ehbp1 UTSW 11 22096000 missense probably damaging 1.00
R1656:Ehbp1 UTSW 11 22146694 missense probably benign
R1696:Ehbp1 UTSW 11 22053441 missense probably damaging 0.99
R1923:Ehbp1 UTSW 11 22151850 missense probably damaging 1.00
R1950:Ehbp1 UTSW 11 22059228 missense probably damaging 1.00
R2263:Ehbp1 UTSW 11 22095462 missense probably benign
R2436:Ehbp1 UTSW 11 22089524 critical splice donor site probably null
R3148:Ehbp1 UTSW 11 22100465 missense probably damaging 1.00
R3973:Ehbp1 UTSW 11 22137867 missense probably benign 0.00
R3974:Ehbp1 UTSW 11 22137867 missense probably benign 0.00
R4030:Ehbp1 UTSW 11 22285498 missense probably damaging 1.00
R4085:Ehbp1 UTSW 11 22095898 missense possibly damaging 0.95
R4089:Ehbp1 UTSW 11 22095898 missense possibly damaging 0.95
R4524:Ehbp1 UTSW 11 22151843 missense probably damaging 1.00
R4641:Ehbp1 UTSW 11 22095892 missense probably benign 0.00
R4873:Ehbp1 UTSW 11 22101164 missense probably damaging 1.00
R4875:Ehbp1 UTSW 11 22101164 missense probably damaging 1.00
R4914:Ehbp1 UTSW 11 22146592 missense probably benign 0.20
R4915:Ehbp1 UTSW 11 22146592 missense probably benign 0.20
R4916:Ehbp1 UTSW 11 22146592 missense probably benign 0.20
R4917:Ehbp1 UTSW 11 22146592 missense probably benign 0.20
R4918:Ehbp1 UTSW 11 22146592 missense probably benign 0.20
R4929:Ehbp1 UTSW 11 22239169 missense possibly damaging 0.48
R4995:Ehbp1 UTSW 11 22101073 missense probably damaging 1.00
R5325:Ehbp1 UTSW 11 22095370 missense possibly damaging 0.93
R5579:Ehbp1 UTSW 11 22137846 missense probably damaging 1.00
R5979:Ehbp1 UTSW 11 22151887 missense probably benign 0.06
R6025:Ehbp1 UTSW 11 22239156 missense probably damaging 1.00
R6259:Ehbp1 UTSW 11 22285684 start gained probably benign
R6685:Ehbp1 UTSW 11 22146641 missense probably benign 0.01
R6893:Ehbp1 UTSW 11 22014945 missense probably damaging 1.00
R7127:Ehbp1 UTSW 11 22053529 nonsense probably null
R7465:Ehbp1 UTSW 11 22138001 missense probably benign
R7722:Ehbp1 UTSW 11 22089572 missense probably null
R7724:Ehbp1 UTSW 11 22089572 missense probably null
R7797:Ehbp1 UTSW 11 22096109 missense possibly damaging 0.79
R7868:Ehbp1 UTSW 11 22146542 nonsense probably null
R8088:Ehbp1 UTSW 11 22089572 missense probably null
R8218:Ehbp1 UTSW 11 22096096 missense possibly damaging 0.77
R8235:Ehbp1 UTSW 11 22239153 missense probably damaging 1.00
R8267:Ehbp1 UTSW 11 22146562 missense probably benign 0.02
R8318:Ehbp1 UTSW 11 22137980 missense probably benign 0.05
R8334:Ehbp1 UTSW 11 22007170 missense probably damaging 1.00
R8425:Ehbp1 UTSW 11 22013495 missense probably damaging 1.00
R8439:Ehbp1 UTSW 11 22096109 missense possibly damaging 0.79
RF016:Ehbp1 UTSW 11 22146646 missense probably benign
RF037:Ehbp1 UTSW 11 22006783 small deletion probably benign
X0018:Ehbp1 UTSW 11 22101085 missense probably damaging 1.00
Z1176:Ehbp1 UTSW 11 22095590 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- AATGTCAGGTTCAGTGCTAACTCGG -3'
(R):5'- AGCTTTGACTGTAGCCTGTCACG -3'

Sequencing Primer
(F):5'- GTTCACACGGTTCTCGTCAT -3'
(R):5'- AAGCTTGGGGTTTCAGAGTG -3'
Posted On2013-05-23