Incidental Mutation 'R0468:Olfr319'
ID41758
Institutional Source Beutler Lab
Gene Symbol Olfr319
Ensembl Gene ENSMUSG00000064044
Gene Nameolfactory receptor 319
SynonymsMOR285-2, GA_x6K02T2NKPP-708319-707399
MMRRC Submission 038668-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.085) question?
Stock #R0468 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location58699162-58703472 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 58701793 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 31 (I31F)
Ref Sequence ENSEMBL: ENSMUSP00000150883 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076965] [ENSMUST00000215962]
Predicted Effect probably damaging
Transcript: ENSMUST00000076965
AA Change: I31F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000076232
Gene: ENSMUSG00000064044
AA Change: I31F

DomainStartEndE-ValueType
Pfam:7tm_4 31 306 3.8e-46 PFAM
Pfam:7tm_1 41 290 1.4e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215238
Predicted Effect probably damaging
Transcript: ENSMUST00000215962
AA Change: I31F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.1925 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.2%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik A G 12: 71,193,310 H1298R possibly damaging Het
5530400C23Rik T C 6: 133,294,458 L155P probably benign Het
6820408C15Rik A T 2: 152,441,266 R283S probably benign Het
Aldh1l2 T A 10: 83,518,678 E104D probably benign Het
Anxa3 T C 5: 96,811,099 V22A probably benign Het
Bcl7b T C 5: 135,180,883 F188L probably benign Het
Brinp1 T A 4: 68,762,776 I506F probably damaging Het
Bsdc1 T C 4: 129,461,718 probably benign Het
Ccdc180 T C 4: 45,923,271 I1075T possibly damaging Het
Cep162 A G 9: 87,193,697 L1294P probably damaging Het
Cltc G A 11: 86,704,626 probably benign Het
Col11a1 T C 3: 114,217,058 probably benign Het
Col14a1 A T 15: 55,388,646 Y566F unknown Het
Dhx29 A G 13: 112,963,277 Q1148R probably benign Het
Ehbp1 A G 11: 22,169,184 probably benign Het
Ehd3 A G 17: 73,805,379 H46R probably damaging Het
Fam171a1 T C 2: 3,225,396 V522A probably benign Het
Gm4553 C A 7: 142,165,625 C22F unknown Het
Hibadh C T 6: 52,557,770 probably benign Het
Hspg2 G A 4: 137,533,529 C1613Y probably damaging Het
Hydin G T 8: 110,413,223 C708F possibly damaging Het
Ifi208 A T 1: 173,683,481 M401L probably benign Het
Igsf8 G A 1: 172,318,796 V454M probably damaging Het
Irx4 G T 13: 73,266,720 probably benign Het
Kcnh4 C T 11: 100,746,932 G633E probably benign Het
Kcnn2 C T 18: 45,559,471 T38M possibly damaging Het
L3mbtl3 C T 10: 26,327,732 R400H unknown Het
Lrp6 T C 6: 134,485,661 T679A possibly damaging Het
Map9 T C 3: 82,374,203 probably null Het
Men1 T A 19: 6,336,923 V5E probably null Het
Mettl14 T C 3: 123,371,412 D93G probably damaging Het
Neb G T 2: 52,211,556 R4601S probably damaging Het
Nell1 A G 7: 50,228,846 T272A probably damaging Het
Olfr1115 A T 2: 87,252,255 N106I probably benign Het
Pclo C A 5: 14,677,288 probably benign Het
Pdia5 A G 16: 35,397,507 L502P probably damaging Het
Pkd1l3 C G 8: 109,623,649 D375E possibly damaging Het
Plxna4 C A 6: 32,215,246 C803F probably damaging Het
Pmfbp1 A G 8: 109,513,968 probably null Het
Ptgs1 A G 2: 36,249,193 Y468C probably damaging Het
Pxdn G T 12: 29,994,486 G488W probably damaging Het
Safb C T 17: 56,606,025 R914C probably damaging Het
Sec31b T A 19: 44,518,508 probably benign Het
Shank3 G A 15: 89,549,275 V1333I probably benign Het
Slamf1 A G 1: 171,792,371 probably benign Het
Slc23a3 T A 1: 75,133,230 Q131L possibly damaging Het
Slc7a11 A G 3: 50,384,051 V303A probably damaging Het
Slc7a13 T A 4: 19,841,500 V449D probably benign Het
Srp68 A T 11: 116,248,764 I453K probably damaging Het
Steap3 A T 1: 120,234,300 V414D probably damaging Het
Tagln2 A G 1: 172,506,221 N131D probably benign Het
Tmem132d T C 5: 128,269,203 Y85C probably damaging Het
Vcam1 A T 3: 116,115,946 Y577* probably null Het
Vmn1r214 A G 13: 23,035,253 T306A probably benign Het
Zfyve1 A T 12: 83,555,274 probably benign Het
Zgrf1 T A 3: 127,562,041 N305K possibly damaging Het
Other mutations in Olfr319
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01398:Olfr319 APN 11 58701767 missense probably benign
IGL01955:Olfr319 APN 11 58702129 missense probably damaging 0.97
IGL02145:Olfr319 APN 11 58702060 missense probably damaging 0.99
IGL02283:Olfr319 APN 11 58702276 missense probably damaging 0.96
R0499:Olfr319 UTSW 11 58702243 missense probably benign 0.01
R0815:Olfr319 UTSW 11 58702609 missense possibly damaging 0.84
R0885:Olfr319 UTSW 11 58702087 missense possibly damaging 0.93
R1081:Olfr319 UTSW 11 58702498 missense probably damaging 1.00
R1603:Olfr319 UTSW 11 58702460 missense probably benign 0.00
R1935:Olfr319 UTSW 11 58702346 missense probably damaging 1.00
R1936:Olfr319 UTSW 11 58702346 missense probably damaging 1.00
R1938:Olfr319 UTSW 11 58702623 makesense probably null
R2436:Olfr319 UTSW 11 58702126 missense probably damaging 0.97
R4243:Olfr319 UTSW 11 58702451 missense probably damaging 1.00
R4244:Olfr319 UTSW 11 58702451 missense probably damaging 1.00
R4742:Olfr319 UTSW 11 58701859 missense probably benign
R4801:Olfr319 UTSW 11 58701791 missense probably benign
R4802:Olfr319 UTSW 11 58701791 missense probably benign
R4927:Olfr319 UTSW 11 58701807 missense probably damaging 1.00
R5259:Olfr319 UTSW 11 58701952 missense probably benign 0.07
R5259:Olfr319 UTSW 11 58701953 missense possibly damaging 0.83
R5393:Olfr319 UTSW 11 58702500 missense probably damaging 0.97
R5471:Olfr319 UTSW 11 58702325 missense probably damaging 0.98
R5571:Olfr319 UTSW 11 58702051 missense probably damaging 1.00
R6746:Olfr319 UTSW 11 58702543 missense probably benign
R7045:Olfr319 UTSW 11 58701669 start gained probably benign
X0065:Olfr319 UTSW 11 58702489 missense probably benign 0.02
Z1177:Olfr319 UTSW 11 58702113 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TGTATGCTCAAGGACAGTCCTCACC -3'
(R):5'- GTCATAGGACATGAAGCCCAGCAG -3'

Sequencing Primer
(F):5'- AGACTTCACCTTGGTTGGTC -3'
(R):5'- TCCTAAAACGGAAATGGCCTTG -3'
Posted On2013-05-23