Incidental Mutation 'R0468:Srp68'
ID41761
Institutional Source Beutler Lab
Gene Symbol Srp68
Ensembl Gene ENSMUSG00000020780
Gene Namesignal recognition particle 68
Synonyms2610024I03Rik
MMRRC Submission 038668-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.956) question?
Stock #R0468 (G1)
Quality Score112
Status Validated
Chromosome11
Chromosomal Location116245166-116274217 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 116248764 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Lysine at position 453 (I453K)
Ref Sequence ENSEMBL: ENSMUSP00000021133 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021133] [ENSMUST00000106425]
Predicted Effect probably damaging
Transcript: ENSMUST00000021133
AA Change: I453K

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000021133
Gene: ENSMUSG00000020780
AA Change: I453K

DomainStartEndE-ValueType
low complexity region 9 34 N/A INTRINSIC
Pfam:SRP68 74 596 5.5e-156 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000106425
AA Change: I415K

PolyPhen 2 Score 0.805 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000102033
Gene: ENSMUSG00000020780
AA Change: I415K

DomainStartEndE-ValueType
low complexity region 9 34 N/A INTRINSIC
PDB:4P3F|B 46 215 1e-112 PDB
Blast:TPR 149 182 5e-15 BLAST
Blast:TPR 424 457 1e-14 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127205
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128808
Meta Mutation Damage Score 0.1865 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.2%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the signal recognition particle (SRP). The SRP is a ribonucleoprotein complex that transports secreted and membrane proteins to the endoplasmic reticulum for processing. The complex includes a 7S RNA and six protein subunits. The encoded protein is the 68kDa component of the SRP, and forms a heterodimer with the 72kDa subunit that is required for SRP function. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene, and three pseudogenes of this gene are located within the Smith-Magenis syndrome region on chromosome 17. [provided by RefSeq, May 2012]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik A G 12: 71,193,310 H1298R possibly damaging Het
5530400C23Rik T C 6: 133,294,458 L155P probably benign Het
6820408C15Rik A T 2: 152,441,266 R283S probably benign Het
Aldh1l2 T A 10: 83,518,678 E104D probably benign Het
Anxa3 T C 5: 96,811,099 V22A probably benign Het
Bcl7b T C 5: 135,180,883 F188L probably benign Het
Brinp1 T A 4: 68,762,776 I506F probably damaging Het
Bsdc1 T C 4: 129,461,718 probably benign Het
Ccdc180 T C 4: 45,923,271 I1075T possibly damaging Het
Cep162 A G 9: 87,193,697 L1294P probably damaging Het
Cltc G A 11: 86,704,626 probably benign Het
Col11a1 T C 3: 114,217,058 probably benign Het
Col14a1 A T 15: 55,388,646 Y566F unknown Het
Dhx29 A G 13: 112,963,277 Q1148R probably benign Het
Ehbp1 A G 11: 22,169,184 probably benign Het
Ehd3 A G 17: 73,805,379 H46R probably damaging Het
Fam171a1 T C 2: 3,225,396 V522A probably benign Het
Gm4553 C A 7: 142,165,625 C22F unknown Het
Hibadh C T 6: 52,557,770 probably benign Het
Hspg2 G A 4: 137,533,529 C1613Y probably damaging Het
Hydin G T 8: 110,413,223 C708F possibly damaging Het
Ifi208 A T 1: 173,683,481 M401L probably benign Het
Igsf8 G A 1: 172,318,796 V454M probably damaging Het
Irx4 G T 13: 73,266,720 probably benign Het
Kcnh4 C T 11: 100,746,932 G633E probably benign Het
Kcnn2 C T 18: 45,559,471 T38M possibly damaging Het
L3mbtl3 C T 10: 26,327,732 R400H unknown Het
Lrp6 T C 6: 134,485,661 T679A possibly damaging Het
Map9 T C 3: 82,374,203 probably null Het
Men1 T A 19: 6,336,923 V5E probably null Het
Mettl14 T C 3: 123,371,412 D93G probably damaging Het
Neb G T 2: 52,211,556 R4601S probably damaging Het
Nell1 A G 7: 50,228,846 T272A probably damaging Het
Olfr1115 A T 2: 87,252,255 N106I probably benign Het
Olfr319 A T 11: 58,701,793 I31F probably damaging Het
Pclo C A 5: 14,677,288 probably benign Het
Pdia5 A G 16: 35,397,507 L502P probably damaging Het
Pkd1l3 C G 8: 109,623,649 D375E possibly damaging Het
Plxna4 C A 6: 32,215,246 C803F probably damaging Het
Pmfbp1 A G 8: 109,513,968 probably null Het
Ptgs1 A G 2: 36,249,193 Y468C probably damaging Het
Pxdn G T 12: 29,994,486 G488W probably damaging Het
Safb C T 17: 56,606,025 R914C probably damaging Het
Sec31b T A 19: 44,518,508 probably benign Het
Shank3 G A 15: 89,549,275 V1333I probably benign Het
Slamf1 A G 1: 171,792,371 probably benign Het
Slc23a3 T A 1: 75,133,230 Q131L possibly damaging Het
Slc7a11 A G 3: 50,384,051 V303A probably damaging Het
Slc7a13 T A 4: 19,841,500 V449D probably benign Het
Steap3 A T 1: 120,234,300 V414D probably damaging Het
Tagln2 A G 1: 172,506,221 N131D probably benign Het
Tmem132d T C 5: 128,269,203 Y85C probably damaging Het
Vcam1 A T 3: 116,115,946 Y577* probably null Het
Vmn1r214 A G 13: 23,035,253 T306A probably benign Het
Zfyve1 A T 12: 83,555,274 probably benign Het
Zgrf1 T A 3: 127,562,041 N305K possibly damaging Het
Other mutations in Srp68
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01654:Srp68 APN 11 116247812 splice site probably benign
IGL02974:Srp68 APN 11 116246225 missense probably benign 0.31
tipsy UTSW 11 116245812 missense probably damaging 1.00
P0028:Srp68 UTSW 11 116260920 missense probably damaging 0.99
R0211:Srp68 UTSW 11 116265551 missense probably damaging 1.00
R0211:Srp68 UTSW 11 116265551 missense probably damaging 1.00
R0796:Srp68 UTSW 11 116246683 missense probably benign 0.12
R1291:Srp68 UTSW 11 116263281 missense probably damaging 1.00
R1906:Srp68 UTSW 11 116250761 missense probably damaging 1.00
R2149:Srp68 UTSW 11 116260867 missense possibly damaging 0.93
R3732:Srp68 UTSW 11 116273956 nonsense probably null
R4651:Srp68 UTSW 11 116274014 missense probably benign
R4652:Srp68 UTSW 11 116274014 missense probably benign
R4686:Srp68 UTSW 11 116265401 missense probably damaging 0.98
R4924:Srp68 UTSW 11 116260858 missense probably damaging 1.00
R5077:Srp68 UTSW 11 116245812 missense probably damaging 1.00
R5095:Srp68 UTSW 11 116248747 missense probably damaging 0.98
R5166:Srp68 UTSW 11 116265474 missense probably damaging 0.99
R5167:Srp68 UTSW 11 116265474 missense probably damaging 0.99
R5168:Srp68 UTSW 11 116265474 missense probably damaging 0.99
R5769:Srp68 UTSW 11 116246669 missense probably damaging 1.00
R6379:Srp68 UTSW 11 116265401 missense probably damaging 1.00
R6577:Srp68 UTSW 11 116265464 missense probably damaging 1.00
R6777:Srp68 UTSW 11 116262904 missense probably damaging 1.00
R7089:Srp68 UTSW 11 116271907 splice site probably null
R7561:Srp68 UTSW 11 116248767 missense probably damaging 0.99
R7823:Srp68 UTSW 11 116265439 missense probably damaging 1.00
R7854:Srp68 UTSW 11 116254083 splice site probably null
R8206:Srp68 UTSW 11 116273983 missense probably damaging 0.98
R8407:Srp68 UTSW 11 116252763 missense probably benign 0.00
Z1088:Srp68 UTSW 11 116274035 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- CCCAATTCAGATTAGGCTCCCGAC -3'
(R):5'- TGACAAATGGGTACAGGGCTGC -3'

Sequencing Primer
(F):5'- CCTGTGGCTCTCTTAGATGAAGAAC -3'
(R):5'- CCTAAAAGGTCTTTGGGGCTTC -3'
Posted On2013-05-23