Mutagenetix > Incidental Mutations

Incidental Mutation 'R0468:2700049A03Rik'

41763

Institutional Source

Beutler Lab

Gene Symbol

2700049A03Rik

Ensembl Gene

ENSMUSG00000034601

Gene Name

RIKEN cDNA 2700049A03 gene

Synonyms

talpid3

MMRRC Submission

038668-MU

Accession Numbers

Genbank: NM_001163378, NM_029818

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R0468 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

71136848-71243303 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 71193310 bp

Zygosity

Heterozygous

Amino Acid Change

Histidine to Arginine at position 1298 (H1298R)

Ref Sequence

ENSEMBL: ENSMUSP00000118956 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000045907] [ENSMUST00000149564]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000045907
AA Change: H1298R

PolyPhen 2 Score 0.711 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000044701
Gene: ENSMUSG00000034601
AA Change: H1298R

Domain	Start	End	E-Value	Type
Pfam:TALPID3	116	1351	N/A	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000149564
AA Change: H1298R

PolyPhen 2 Score 0.711 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000118956
Gene: ENSMUSG00000034601
AA Change: H1298R

Domain	Start	End	E-Value	Type
Pfam:TALPID3	116	1349	N/A	PFAM

Meta Mutation Damage Score

0.1587

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.8%
20x: 94.2%

Validation Efficiency

100% (61/61)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a conserved centrosomal protein that functions in ciliogenesis and responds to hedgehog signaling. Mutations in this gene causes Joubert syndrome 23. Alternative splicing results in multiple transcript variants and protein isoforms. [provided by RefSeq, Aug 2016]
PHENOTYPE: Mice homozygous for a null allele die during organogenesis, lack cilia, and show randomized L-R patterning, face and neural tube defects, pericardial edema and hemorrhages. Mouse embryonic fibroblasts homozygous for a different null allele lack cilia and asymmetrical centriolar localization. [provided by MGI curators]

Allele List at MGI

All alleles(12) : Targeted, other(2) Gene trapped(10)

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5530400C23Rik	T	C	6: 133,294,458	L155P	probably benign	Het
6820408C15Rik	A	T	2: 152,441,266	R283S	probably benign	Het
Aldh1l2	T	A	10: 83,518,678	E104D	probably benign	Het
Anxa3	T	C	5: 96,811,099	V22A	probably benign	Het
Bcl7b	T	C	5: 135,180,883	F188L	probably benign	Het
Brinp1	T	A	4: 68,762,776	I506F	probably damaging	Het
Bsdc1	T	C	4: 129,461,718		probably benign	Het
Ccdc180	T	C	4: 45,923,271	I1075T	possibly damaging	Het
Cep162	A	G	9: 87,193,697	L1294P	probably damaging	Het
Cltc	G	A	11: 86,704,626		probably benign	Het
Col11a1	T	C	3: 114,217,058		probably benign	Het
Col14a1	A	T	15: 55,388,646	Y566F	unknown	Het
Dhx29	A	G	13: 112,963,277	Q1148R	probably benign	Het
Ehbp1	A	G	11: 22,169,184		probably benign	Het
Ehd3	A	G	17: 73,805,379	H46R	probably damaging	Het
Fam171a1	T	C	2: 3,225,396	V522A	probably benign	Het
Gm4553	C	A	7: 142,165,625	C22F	unknown	Het
Hibadh	C	T	6: 52,557,770		probably benign	Het
Hspg2	G	A	4: 137,533,529	C1613Y	probably damaging	Het
Hydin	G	T	8: 110,413,223	C708F	possibly damaging	Het
Ifi208	A	T	1: 173,683,481	M401L	probably benign	Het
Igsf8	G	A	1: 172,318,796	V454M	probably damaging	Het
Irx4	G	T	13: 73,266,720		probably benign	Het
Kcnh4	C	T	11: 100,746,932	G633E	probably benign	Het
Kcnn2	C	T	18: 45,559,471	T38M	possibly damaging	Het
L3mbtl3	C	T	10: 26,327,732	R400H	unknown	Het
Lrp6	T	C	6: 134,485,661	T679A	possibly damaging	Het
Map9	T	C	3: 82,374,203		probably null	Het
Men1	T	A	19: 6,336,923	V5E	probably null	Het
Mettl14	T	C	3: 123,371,412	D93G	probably damaging	Het
Neb	G	T	2: 52,211,556	R4601S	probably damaging	Het
Nell1	A	G	7: 50,228,846	T272A	probably damaging	Het
Olfr1115	A	T	2: 87,252,255	N106I	probably benign	Het
Olfr319	A	T	11: 58,701,793	I31F	probably damaging	Het
Pclo	C	A	5: 14,677,288		probably benign	Het
Pdia5	A	G	16: 35,397,507	L502P	probably damaging	Het
Pkd1l3	C	G	8: 109,623,649	D375E	possibly damaging	Het
Plxna4	C	A	6: 32,215,246	C803F	probably damaging	Het
Pmfbp1	A	G	8: 109,513,968		probably null	Het
Ptgs1	A	G	2: 36,249,193	Y468C	probably damaging	Het
Pxdn	G	T	12: 29,994,486	G488W	probably damaging	Het
Safb	C	T	17: 56,606,025	R914C	probably damaging	Het
Sec31b	T	A	19: 44,518,508		probably benign	Het
Shank3	G	A	15: 89,549,275	V1333I	probably benign	Het
Slamf1	A	G	1: 171,792,371		probably benign	Het
Slc23a3	T	A	1: 75,133,230	Q131L	possibly damaging	Het
Slc7a11	A	G	3: 50,384,051	V303A	probably damaging	Het
Slc7a13	T	A	4: 19,841,500	V449D	probably benign	Het
Srp68	A	T	11: 116,248,764	I453K	probably damaging	Het
Steap3	A	T	1: 120,234,300	V414D	probably damaging	Het
Tagln2	A	G	1: 172,506,221	N131D	probably benign	Het
Tmem132d	T	C	5: 128,269,203	Y85C	probably damaging	Het
Vcam1	A	T	3: 116,115,946	Y577*	probably null	Het
Vmn1r214	A	G	13: 23,035,253	T306A	probably benign	Het
Zfyve1	A	T	12: 83,555,274		probably benign	Het
Zgrf1	T	A	3: 127,562,041	N305K	possibly damaging	Het

Other mutations in 2700049A03Rik

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00339:2700049A03Rik	APN	12	71167119	missense	probably benign	0.00
IGL01107:2700049A03Rik	APN	12	71194468	critical splice donor site	probably null
IGL01404:2700049A03Rik	APN	12	71164378	splice site	probably null
IGL01835:2700049A03Rik	APN	12	71167181	nonsense	probably null
IGL01835:2700049A03Rik	APN	12	71167183	missense	probably benign	0.00
IGL02122:2700049A03Rik	APN	12	71170525	missense	possibly damaging	0.93
IGL02140:2700049A03Rik	APN	12	71148260	missense	probably benign	0.06
IGL02385:2700049A03Rik	APN	12	71154856	missense	probably damaging	0.98
IGL03181:2700049A03Rik	APN	12	71193373	missense	possibly damaging	0.51
IGL03253:2700049A03Rik	APN	12	71140883	missense	probably benign	0.33
IGL03278:2700049A03Rik	APN	12	71158825	splice site	probably benign
G4846:2700049A03Rik	UTSW	12	71137909	missense	probably benign
PIT1430001:2700049A03Rik	UTSW	12	71160386	missense	possibly damaging	0.71
PIT4519001:2700049A03Rik	UTSW	12	71170666	missense	probably benign	0.05
R0108:2700049A03Rik	UTSW	12	71177918	missense	probably benign	0.14
R0165:2700049A03Rik	UTSW	12	71167150	missense	possibly damaging	0.52
R0211:2700049A03Rik	UTSW	12	71216096	missense	possibly damaging	0.96
R0211:2700049A03Rik	UTSW	12	71216096	missense	possibly damaging	0.96
R0220:2700049A03Rik	UTSW	12	71148420	critical splice donor site	probably null
R0352:2700049A03Rik	UTSW	12	71138030	missense	possibly damaging	0.96
R0508:2700049A03Rik	UTSW	12	71164388	missense	probably damaging	0.98
R0673:2700049A03Rik	UTSW	12	71177868	missense	probably damaging	0.97
R0840:2700049A03Rik	UTSW	12	71158883	missense	probably benign	0.16
R0893:2700049A03Rik	UTSW	12	71219308	splice site	probably benign
R1244:2700049A03Rik	UTSW	12	71216144	missense	probably benign	0.25
R1432:2700049A03Rik	UTSW	12	71170587	unclassified	probably null
R1599:2700049A03Rik	UTSW	12	71150259	missense	probably damaging	0.98
R1732:2700049A03Rik	UTSW	12	71219221	missense	probably benign	0.18
R1820:2700049A03Rik	UTSW	12	71150244	missense	possibly damaging	0.51
R1939:2700049A03Rik	UTSW	12	71160412	splice site	probably null
R1998:2700049A03Rik	UTSW	12	71188619	missense	possibly damaging	0.86
R2337:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R2337:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R2340:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R2340:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R2382:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R2382:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R2384:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R2384:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R2445:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R2445:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R2449:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R2449:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R2512:2700049A03Rik	UTSW	12	71173171	missense	possibly damaging	0.71
R2872:2700049A03Rik	UTSW	12	71154756	splice site	probably benign
R3236:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R3236:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R3237:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R3237:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R3734:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R3734:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R3808:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R3808:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R3809:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R3809:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R3944:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R3944:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R3959:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R3959:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R3960:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R3960:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R4593:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R4593:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R4595:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R4595:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R4596:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R4596:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R4600:2700049A03Rik	UTSW	12	71148263	missense	possibly damaging	0.67
R4649:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R4649:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R4651:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R4651:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R4652:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R4652:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R4714:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R4714:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R4735:2700049A03Rik	UTSW	12	71216123	missense	possibly damaging	0.88
R4810:2700049A03Rik	UTSW	12	71189442	missense	possibly damaging	0.51
R4852:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R4852:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R4854:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R4854:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R4855:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R4855:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R4884:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R4884:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R4893:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R4893:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R4905:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R4905:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R4915:2700049A03Rik	UTSW	12	71189646	missense	possibly damaging	0.92
R4919:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R4919:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R4959:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R4959:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R4989:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R4989:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R5011:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R5011:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R5012:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R5012:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R5118:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R5118:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R5146:2700049A03Rik	UTSW	12	71243025	missense	possibly damaging	0.85
R5163:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R5163:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R5188:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R5188:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R5189:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R5189:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R5189:2700049A03Rik	UTSW	12	71193349	missense	possibly damaging	0.93
R5190:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R5190:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R5290:2700049A03Rik	UTSW	12	71188791	missense	probably benign	0.00
R5344:2700049A03Rik	UTSW	12	71243027	missense	probably benign
R5502:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R5502:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R5503:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R5503:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R5619:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R5619:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R5667:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R5667:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R5669:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R5669:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R5671:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R5671:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R5725:2700049A03Rik	UTSW	12	71193319	missense	probably benign	0.05
R5956:2700049A03Rik	UTSW	12	71157119	missense	possibly damaging	0.86
R6051:2700049A03Rik	UTSW	12	71184530	missense	possibly damaging	0.84
R6148:2700049A03Rik	UTSW	12	71187426	missense	possibly damaging	0.71
R6158:2700049A03Rik	UTSW	12	71170636	missense	possibly damaging	0.51
R6916:2700049A03Rik	UTSW	12	71164544	missense	possibly damaging	0.86
R7129:2700049A03Rik	UTSW	12	71216230	intron	probably null
R7168:2700049A03Rik	UTSW	12	71216057	missense	probably damaging	0.98
R7193:2700049A03Rik	UTSW	12	71219189	critical splice acceptor site	probably null
R7200:2700049A03Rik	UTSW	12	71140906	missense	probably damaging	0.96
R7359:2700049A03Rik	UTSW	12	71189574	missense	possibly damaging	0.51
R7488:2700049A03Rik	UTSW	12	71150405	missense	possibly damaging	0.67
R7755:2700049A03Rik	UTSW	12	71189413	missense	probably benign	0.02
R7757:2700049A03Rik	UTSW	12	71189413	missense	probably benign	0.02

Predicted Primers

PCR Primer
(F):5'- TCAAATGGCAATGAGAGCTACATGACAA -3'
(R):5'- TGGAACCGAacacacacacacac -3'

Sequencing Primer
(F):5'- CAATGAGAGCTACATGACAATAGTG -3'
(R):5'- acacatacacacacacatacatac -3'

Posted On

2013-05-23