Incidental Mutation 'R0468:Zfyve1'
ID41764
Institutional Source Beutler Lab
Gene Symbol Zfyve1
Ensembl Gene ENSMUSG00000042628
Gene Namezinc finger, FYVE domain containing 1
Synonyms
MMRRC Submission 038668-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0468 (G1)
Quality Score189
Status Validated
Chromosome12
Chromosomal Location83546558-83597222 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 83555274 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000152864 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048319] [ENSMUST00000221919] [ENSMUST00000222448]
Predicted Effect probably benign
Transcript: ENSMUST00000048319
SMART Domains Protein: ENSMUSP00000042224
Gene: ENSMUSG00000042628

DomainStartEndE-ValueType
low complexity region 429 436 N/A INTRINSIC
FYVE 590 660 8.36e-13 SMART
FYVE 707 776 1.15e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221228
Predicted Effect probably benign
Transcript: ENSMUST00000221919
Predicted Effect probably benign
Transcript: ENSMUST00000222448
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.2%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The FYVE domain mediates the recruitment of proteins involved in membrane trafficking and cell signaling to phosphatidylinositol 3-phosphate-containing membranes. This protein contains two zinc-binding FYVE domains in tandem and is reported to localize to the Golgi apparatus. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2013]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik A G 12: 71,193,310 H1298R possibly damaging Het
5530400C23Rik T C 6: 133,294,458 L155P probably benign Het
6820408C15Rik A T 2: 152,441,266 R283S probably benign Het
Aldh1l2 T A 10: 83,518,678 E104D probably benign Het
Anxa3 T C 5: 96,811,099 V22A probably benign Het
Bcl7b T C 5: 135,180,883 F188L probably benign Het
Brinp1 T A 4: 68,762,776 I506F probably damaging Het
Bsdc1 T C 4: 129,461,718 probably benign Het
Ccdc180 T C 4: 45,923,271 I1075T possibly damaging Het
Cep162 A G 9: 87,193,697 L1294P probably damaging Het
Cltc G A 11: 86,704,626 probably benign Het
Col11a1 T C 3: 114,217,058 probably benign Het
Col14a1 A T 15: 55,388,646 Y566F unknown Het
Dhx29 A G 13: 112,963,277 Q1148R probably benign Het
Ehbp1 A G 11: 22,169,184 probably benign Het
Ehd3 A G 17: 73,805,379 H46R probably damaging Het
Fam171a1 T C 2: 3,225,396 V522A probably benign Het
Gm4553 C A 7: 142,165,625 C22F unknown Het
Hibadh C T 6: 52,557,770 probably benign Het
Hspg2 G A 4: 137,533,529 C1613Y probably damaging Het
Hydin G T 8: 110,413,223 C708F possibly damaging Het
Ifi208 A T 1: 173,683,481 M401L probably benign Het
Igsf8 G A 1: 172,318,796 V454M probably damaging Het
Irx4 G T 13: 73,266,720 probably benign Het
Kcnh4 C T 11: 100,746,932 G633E probably benign Het
Kcnn2 C T 18: 45,559,471 T38M possibly damaging Het
L3mbtl3 C T 10: 26,327,732 R400H unknown Het
Lrp6 T C 6: 134,485,661 T679A possibly damaging Het
Map9 T C 3: 82,374,203 probably null Het
Men1 T A 19: 6,336,923 V5E probably null Het
Mettl14 T C 3: 123,371,412 D93G probably damaging Het
Neb G T 2: 52,211,556 R4601S probably damaging Het
Nell1 A G 7: 50,228,846 T272A probably damaging Het
Olfr1115 A T 2: 87,252,255 N106I probably benign Het
Olfr319 A T 11: 58,701,793 I31F probably damaging Het
Pclo C A 5: 14,677,288 probably benign Het
Pdia5 A G 16: 35,397,507 L502P probably damaging Het
Pkd1l3 C G 8: 109,623,649 D375E possibly damaging Het
Plxna4 C A 6: 32,215,246 C803F probably damaging Het
Pmfbp1 A G 8: 109,513,968 probably null Het
Ptgs1 A G 2: 36,249,193 Y468C probably damaging Het
Pxdn G T 12: 29,994,486 G488W probably damaging Het
Safb C T 17: 56,606,025 R914C probably damaging Het
Sec31b T A 19: 44,518,508 probably benign Het
Shank3 G A 15: 89,549,275 V1333I probably benign Het
Slamf1 A G 1: 171,792,371 probably benign Het
Slc23a3 T A 1: 75,133,230 Q131L possibly damaging Het
Slc7a11 A G 3: 50,384,051 V303A probably damaging Het
Slc7a13 T A 4: 19,841,500 V449D probably benign Het
Srp68 A T 11: 116,248,764 I453K probably damaging Het
Steap3 A T 1: 120,234,300 V414D probably damaging Het
Tagln2 A G 1: 172,506,221 N131D probably benign Het
Tmem132d T C 5: 128,269,203 Y85C probably damaging Het
Vcam1 A T 3: 116,115,946 Y577* probably null Het
Vmn1r214 A G 13: 23,035,253 T306A probably benign Het
Zgrf1 T A 3: 127,562,041 N305K possibly damaging Het
Other mutations in Zfyve1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00334:Zfyve1 APN 12 83574798 missense probably benign 0.09
IGL00475:Zfyve1 APN 12 83555711 critical splice acceptor site probably null
IGL01291:Zfyve1 APN 12 83555005 missense probably benign 0.04
IGL01380:Zfyve1 APN 12 83552507 missense probably damaging 1.00
IGL02037:Zfyve1 APN 12 83547920 missense probably damaging 1.00
IGL02184:Zfyve1 APN 12 83558693 missense probably benign 0.29
IGL02619:Zfyve1 APN 12 83550944 unclassified probably benign
IGL03031:Zfyve1 APN 12 83574821 missense probably damaging 0.99
IGL03105:Zfyve1 APN 12 83558639 missense probably damaging 1.00
sasso UTSW 12 83575056 missense probably damaging 1.00
ANU05:Zfyve1 UTSW 12 83555005 missense probably benign 0.04
R0123:Zfyve1 UTSW 12 83555073 splice site probably benign
R0225:Zfyve1 UTSW 12 83555073 splice site probably benign
R1218:Zfyve1 UTSW 12 83548051 missense possibly damaging 0.79
R1896:Zfyve1 UTSW 12 83555614 missense probably damaging 0.99
R2291:Zfyve1 UTSW 12 83547931 missense probably damaging 0.99
R4023:Zfyve1 UTSW 12 83594522 missense probably benign
R4026:Zfyve1 UTSW 12 83594522 missense probably benign
R4209:Zfyve1 UTSW 12 83575135 missense probably damaging 1.00
R4211:Zfyve1 UTSW 12 83575135 missense probably damaging 1.00
R4780:Zfyve1 UTSW 12 83558647 missense probably damaging 1.00
R4907:Zfyve1 UTSW 12 83574872 missense probably damaging 0.96
R4908:Zfyve1 UTSW 12 83551571 missense probably damaging 1.00
R4998:Zfyve1 UTSW 12 83548065 missense possibly damaging 0.69
R5076:Zfyve1 UTSW 12 83555647 missense probably damaging 1.00
R5303:Zfyve1 UTSW 12 83575056 missense probably damaging 1.00
R5628:Zfyve1 UTSW 12 83574889 missense probably benign 0.00
R5739:Zfyve1 UTSW 12 83575136 missense possibly damaging 0.61
R6007:Zfyve1 UTSW 12 83558704 missense probably damaging 1.00
R6355:Zfyve1 UTSW 12 83594641 missense probably benign 0.01
R6641:Zfyve1 UTSW 12 83594496 missense probably benign
R6735:Zfyve1 UTSW 12 83594844 missense possibly damaging 0.90
R7222:Zfyve1 UTSW 12 83555005 missense probably benign
R7278:Zfyve1 UTSW 12 83551540 missense probably damaging 1.00
R7464:Zfyve1 UTSW 12 83551487 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GAATGGTTCTTACTCCAGGCCACAC -3'
(R):5'- GCAGAGCTTCTTCTCAGGAAACCAC -3'

Sequencing Primer
(F):5'- TCAGTAAGTCAGCAGTGGTACTC -3'
(R):5'- CTTCTCAGGAAACCACTGTAGATGG -3'
Posted On2013-05-23