Incidental Mutation 'R0468:Dhx29'
ID41767
Institutional Source Beutler Lab
Gene Symbol Dhx29
Ensembl Gene ENSMUSG00000042426
Gene NameDEAH (Asp-Glu-Ala-His) box polypeptide 29
SynonymsE130202M19Rik
MMRRC Submission 038668-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0468 (G1)
Quality Score190
Status Validated
Chromosome13
Chromosomal Location112927454-112969432 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 112963277 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Arginine at position 1148 (Q1148R)
Ref Sequence ENSEMBL: ENSMUSP00000035244 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038574]
Predicted Effect probably benign
Transcript: ENSMUST00000038574
AA Change: Q1148R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000035244
Gene: ENSMUSG00000042426
AA Change: Q1148R

DomainStartEndE-ValueType
low complexity region 10 36 N/A INTRINSIC
low complexity region 41 54 N/A INTRINSIC
low complexity region 209 225 N/A INTRINSIC
low complexity region 240 255 N/A INTRINSIC
coiled coil region 279 308 N/A INTRINSIC
low complexity region 343 358 N/A INTRINSIC
Blast:DEXDc 411 450 2e-14 BLAST
DEXDc 569 763 1.09e-27 SMART
low complexity region 846 856 N/A INTRINSIC
HELICc 880 985 6.1e-17 SMART
HA2 1047 1138 8.9e-26 SMART
Pfam:OB_NTP_bind 1178 1298 3.8e-19 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.2%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the DEAH (Asp-Glu-Ala-His) subfamily of proteins, part of the DEAD (Asp-Glu-Ala-Asp) box family of RNA helicases. The encoded protein functions in translation initiation, and is specifically required for ribosomal scanning across stable mRNA secondary structures during initiation codon selection. This protein may also play a role in sensing virally derived cytosolic nucleic acids. Knockdown of this gene results in reduced protein translation and impaired proliferation of cancer cells. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit embryonic lethality at E7. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik A G 12: 71,193,310 H1298R possibly damaging Het
5530400C23Rik T C 6: 133,294,458 L155P probably benign Het
6820408C15Rik A T 2: 152,441,266 R283S probably benign Het
Aldh1l2 T A 10: 83,518,678 E104D probably benign Het
Anxa3 T C 5: 96,811,099 V22A probably benign Het
Bcl7b T C 5: 135,180,883 F188L probably benign Het
Brinp1 T A 4: 68,762,776 I506F probably damaging Het
Bsdc1 T C 4: 129,461,718 probably benign Het
Ccdc180 T C 4: 45,923,271 I1075T possibly damaging Het
Cep162 A G 9: 87,193,697 L1294P probably damaging Het
Cltc G A 11: 86,704,626 probably benign Het
Col11a1 T C 3: 114,217,058 probably benign Het
Col14a1 A T 15: 55,388,646 Y566F unknown Het
Ehbp1 A G 11: 22,169,184 probably benign Het
Ehd3 A G 17: 73,805,379 H46R probably damaging Het
Fam171a1 T C 2: 3,225,396 V522A probably benign Het
Gm4553 C A 7: 142,165,625 C22F unknown Het
Hibadh C T 6: 52,557,770 probably benign Het
Hspg2 G A 4: 137,533,529 C1613Y probably damaging Het
Hydin G T 8: 110,413,223 C708F possibly damaging Het
Ifi208 A T 1: 173,683,481 M401L probably benign Het
Igsf8 G A 1: 172,318,796 V454M probably damaging Het
Irx4 G T 13: 73,266,720 probably benign Het
Kcnh4 C T 11: 100,746,932 G633E probably benign Het
Kcnn2 C T 18: 45,559,471 T38M possibly damaging Het
L3mbtl3 C T 10: 26,327,732 R400H unknown Het
Lrp6 T C 6: 134,485,661 T679A possibly damaging Het
Map9 T C 3: 82,374,203 probably null Het
Men1 T A 19: 6,336,923 V5E probably null Het
Mettl14 T C 3: 123,371,412 D93G probably damaging Het
Neb G T 2: 52,211,556 R4601S probably damaging Het
Nell1 A G 7: 50,228,846 T272A probably damaging Het
Olfr1115 A T 2: 87,252,255 N106I probably benign Het
Olfr319 A T 11: 58,701,793 I31F probably damaging Het
Pclo C A 5: 14,677,288 probably benign Het
Pdia5 A G 16: 35,397,507 L502P probably damaging Het
Pkd1l3 C G 8: 109,623,649 D375E possibly damaging Het
Plxna4 C A 6: 32,215,246 C803F probably damaging Het
Pmfbp1 A G 8: 109,513,968 probably null Het
Ptgs1 A G 2: 36,249,193 Y468C probably damaging Het
Pxdn G T 12: 29,994,486 G488W probably damaging Het
Safb C T 17: 56,606,025 R914C probably damaging Het
Sec31b T A 19: 44,518,508 probably benign Het
Shank3 G A 15: 89,549,275 V1333I probably benign Het
Slamf1 A G 1: 171,792,371 probably benign Het
Slc23a3 T A 1: 75,133,230 Q131L possibly damaging Het
Slc7a11 A G 3: 50,384,051 V303A probably damaging Het
Slc7a13 T A 4: 19,841,500 V449D probably benign Het
Srp68 A T 11: 116,248,764 I453K probably damaging Het
Steap3 A T 1: 120,234,300 V414D probably damaging Het
Tagln2 A G 1: 172,506,221 N131D probably benign Het
Tmem132d T C 5: 128,269,203 Y85C probably damaging Het
Vcam1 A T 3: 116,115,946 Y577* probably null Het
Vmn1r214 A G 13: 23,035,253 T306A probably benign Het
Zfyve1 A T 12: 83,555,274 probably benign Het
Zgrf1 T A 3: 127,562,041 N305K possibly damaging Het
Other mutations in Dhx29
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00337:Dhx29 APN 13 112964603 missense probably benign 0.15
IGL00434:Dhx29 APN 13 112955225 missense probably benign 0.00
IGL00659:Dhx29 APN 13 112966635 splice site probably benign
IGL01618:Dhx29 APN 13 112965222 missense probably damaging 1.00
IGL01777:Dhx29 APN 13 112930872 missense probably benign 0.42
IGL02010:Dhx29 APN 13 112966634 critical splice donor site probably null
IGL02125:Dhx29 APN 13 112955300 splice site probably benign
IGL02324:Dhx29 APN 13 112927808 missense probably damaging 1.00
IGL02801:Dhx29 APN 13 112964646 missense probably damaging 1.00
R0001:Dhx29 UTSW 13 112964556 missense probably damaging 0.99
R0362:Dhx29 UTSW 13 112962859 missense probably benign
R0569:Dhx29 UTSW 13 112948214 missense probably benign 0.01
R0714:Dhx29 UTSW 13 112927965 missense possibly damaging 0.55
R1460:Dhx29 UTSW 13 112965210 splice site probably benign
R1579:Dhx29 UTSW 13 112935598 critical splice donor site probably null
R1657:Dhx29 UTSW 13 112952843 missense probably damaging 1.00
R1735:Dhx29 UTSW 13 112945086 missense probably benign 0.00
R1768:Dhx29 UTSW 13 112948240 missense probably damaging 1.00
R1851:Dhx29 UTSW 13 112948281 missense probably damaging 1.00
R1937:Dhx29 UTSW 13 112965330 missense probably benign 0.06
R2180:Dhx29 UTSW 13 112962872 critical splice donor site probably null
R2219:Dhx29 UTSW 13 112952804 missense probably damaging 1.00
R2442:Dhx29 UTSW 13 112946974 missense possibly damaging 0.94
R2679:Dhx29 UTSW 13 112947376 critical splice donor site probably null
R2908:Dhx29 UTSW 13 112927851 missense possibly damaging 0.78
R2912:Dhx29 UTSW 13 112935575 missense probably damaging 1.00
R3414:Dhx29 UTSW 13 112947273 missense probably damaging 0.99
R3931:Dhx29 UTSW 13 112958965 missense probably damaging 1.00
R3957:Dhx29 UTSW 13 112930921 missense probably benign
R4065:Dhx29 UTSW 13 112964742 critical splice donor site probably null
R4207:Dhx29 UTSW 13 112927949 missense probably benign 0.01
R4422:Dhx29 UTSW 13 112947247 missense probably damaging 1.00
R4717:Dhx29 UTSW 13 112946935 missense unknown
R4718:Dhx29 UTSW 13 112946935 missense unknown
R5125:Dhx29 UTSW 13 112932600 missense possibly damaging 0.81
R5178:Dhx29 UTSW 13 112932600 missense possibly damaging 0.81
R5263:Dhx29 UTSW 13 112948221 missense probably damaging 1.00
R5458:Dhx29 UTSW 13 112966621 missense probably benign 0.00
R5469:Dhx29 UTSW 13 112944539 missense possibly damaging 0.94
R5541:Dhx29 UTSW 13 112940374 missense possibly damaging 0.47
R5573:Dhx29 UTSW 13 112933215 missense probably benign 0.07
R5664:Dhx29 UTSW 13 112946879 missense probably damaging 1.00
R5682:Dhx29 UTSW 13 112930849 missense probably damaging 1.00
R5769:Dhx29 UTSW 13 112953717 missense probably damaging 0.99
R5917:Dhx29 UTSW 13 112962843 missense probably damaging 1.00
R5928:Dhx29 UTSW 13 112964468 missense probably benign 0.00
R6115:Dhx29 UTSW 13 112952801 critical splice acceptor site probably null
R6144:Dhx29 UTSW 13 112964571 missense probably damaging 1.00
R6195:Dhx29 UTSW 13 112964537 missense probably benign 0.08
R6233:Dhx29 UTSW 13 112964537 missense probably benign 0.08
R6430:Dhx29 UTSW 13 112944619 missense possibly damaging 0.77
R6480:Dhx29 UTSW 13 112953788 nonsense probably null
R6527:Dhx29 UTSW 13 112932542 missense probably damaging 1.00
R6856:Dhx29 UTSW 13 112952861 missense probably benign 0.43
R7391:Dhx29 UTSW 13 112962859 missense probably benign
R7555:Dhx29 UTSW 13 112927642 start gained probably benign
R7602:Dhx29 UTSW 13 112944559 missense possibly damaging 0.95
Z1177:Dhx29 UTSW 13 112955517 missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- TCAGCCAGTGACTAGAGATGGGTG -3'
(R):5'- GCCGGGAAGAACCCTAGATAATGC -3'

Sequencing Primer
(F):5'- TTATCATTCAAACTGTGCTCTAGC -3'
(R):5'- GAACCCTAGATAATGCCCTTTGAG -3'
Posted On2013-05-23