Incidental Mutation 'R0468:Safb'
ID41771
Institutional Source Beutler Lab
Gene Symbol Safb
Ensembl Gene ENSMUSG00000071054
Gene Namescaffold attachment factor B
Synonyms3110021E02Rik, SAFB1, 5330423C17Rik
MMRRC Submission 038668-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.723) question?
Stock #R0468 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location56584825-56606294 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 56606025 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 914 (R914C)
Ref Sequence ENSEMBL: ENSMUSP00000138277 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052832] [ENSMUST00000095224] [ENSMUST00000182533]
Predicted Effect probably benign
Transcript: ENSMUST00000052832
SMART Domains Protein: ENSMUSP00000052908
Gene: ENSMUSG00000049760

DomainStartEndE-ValueType
Pfam:QIL1 9 108 5.9e-29 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000095224
AA Change: R912C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000092849
Gene: ENSMUSG00000071054
AA Change: R912C

DomainStartEndE-ValueType
low complexity region 11 24 N/A INTRINSIC
SAP 31 65 7.15e-11 SMART
coiled coil region 268 291 N/A INTRINSIC
low complexity region 292 300 N/A INTRINSIC
RRM 429 502 3.76e-19 SMART
coiled coil region 651 728 N/A INTRINSIC
low complexity region 760 778 N/A INTRINSIC
low complexity region 885 898 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182378
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182454
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182461
Predicted Effect probably damaging
Transcript: ENSMUST00000182533
AA Change: R914C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000138277
Gene: ENSMUSG00000071054
AA Change: R914C

DomainStartEndE-ValueType
low complexity region 11 24 N/A INTRINSIC
SAP 31 65 7.15e-11 SMART
coiled coil region 268 291 N/A INTRINSIC
low complexity region 292 300 N/A INTRINSIC
RRM 429 502 3.76e-19 SMART
coiled coil region 651 728 N/A INTRINSIC
low complexity region 760 778 N/A INTRINSIC
low complexity region 831 842 N/A INTRINSIC
low complexity region 887 900 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182913
Predicted Effect probably benign
Transcript: ENSMUST00000182951
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183041
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183318
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.2%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a DNA-binding protein which has high specificity for scaffold or matrix attachment region DNA elements (S/MAR DNA). This protein is thought to be involved in attaching the base of chromatin loops to the nuclear matrix but there is conflicting evidence as to whether this protein is a component of chromatin or a nuclear matrix protein. Scaffold attachment factors are a specific subset of nuclear matrix proteins (NMP) that specifically bind to S/MAR. The encoded protein is thought to serve as a molecular base to assemble a 'transcriptosome complex' in the vicinity of actively transcribed genes. It is involved in the regulation of heat shock protein 27 transcription, can act as an estrogen receptor co-repressor and is a candidate for breast tumorigenesis. This gene is arranged head-to-head with a similar gene whose product has the same functions. Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Jan 2011]
PHENOTYPE: Homozygous null mice display partial embryonic and neonatal lethality, neonatal cyanosis, impaired embryonic hematopoiesis, male sterility, azoospermia, reduced female fertility, impaired transport of embryos through the oviduct, reduced embryonic growth, testicular degeneration and ovarian atrophy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik A G 12: 71,193,310 H1298R possibly damaging Het
5530400C23Rik T C 6: 133,294,458 L155P probably benign Het
6820408C15Rik A T 2: 152,441,266 R283S probably benign Het
Aldh1l2 T A 10: 83,518,678 E104D probably benign Het
Anxa3 T C 5: 96,811,099 V22A probably benign Het
Bcl7b T C 5: 135,180,883 F188L probably benign Het
Brinp1 T A 4: 68,762,776 I506F probably damaging Het
Bsdc1 T C 4: 129,461,718 probably benign Het
Ccdc180 T C 4: 45,923,271 I1075T possibly damaging Het
Cep162 A G 9: 87,193,697 L1294P probably damaging Het
Cltc G A 11: 86,704,626 probably benign Het
Col11a1 T C 3: 114,217,058 probably benign Het
Col14a1 A T 15: 55,388,646 Y566F unknown Het
Dhx29 A G 13: 112,963,277 Q1148R probably benign Het
Ehbp1 A G 11: 22,169,184 probably benign Het
Ehd3 A G 17: 73,805,379 H46R probably damaging Het
Fam171a1 T C 2: 3,225,396 V522A probably benign Het
Gm4553 C A 7: 142,165,625 C22F unknown Het
Hibadh C T 6: 52,557,770 probably benign Het
Hspg2 G A 4: 137,533,529 C1613Y probably damaging Het
Hydin G T 8: 110,413,223 C708F possibly damaging Het
Ifi208 A T 1: 173,683,481 M401L probably benign Het
Igsf8 G A 1: 172,318,796 V454M probably damaging Het
Irx4 G T 13: 73,266,720 probably benign Het
Kcnh4 C T 11: 100,746,932 G633E probably benign Het
Kcnn2 C T 18: 45,559,471 T38M possibly damaging Het
L3mbtl3 C T 10: 26,327,732 R400H unknown Het
Lrp6 T C 6: 134,485,661 T679A possibly damaging Het
Map9 T C 3: 82,374,203 probably null Het
Men1 T A 19: 6,336,923 V5E probably null Het
Mettl14 T C 3: 123,371,412 D93G probably damaging Het
Neb G T 2: 52,211,556 R4601S probably damaging Het
Nell1 A G 7: 50,228,846 T272A probably damaging Het
Olfr1115 A T 2: 87,252,255 N106I probably benign Het
Olfr319 A T 11: 58,701,793 I31F probably damaging Het
Pclo C A 5: 14,677,288 probably benign Het
Pdia5 A G 16: 35,397,507 L502P probably damaging Het
Pkd1l3 C G 8: 109,623,649 D375E possibly damaging Het
Plxna4 C A 6: 32,215,246 C803F probably damaging Het
Pmfbp1 A G 8: 109,513,968 probably null Het
Ptgs1 A G 2: 36,249,193 Y468C probably damaging Het
Pxdn G T 12: 29,994,486 G488W probably damaging Het
Sec31b T A 19: 44,518,508 probably benign Het
Shank3 G A 15: 89,549,275 V1333I probably benign Het
Slamf1 A G 1: 171,792,371 probably benign Het
Slc23a3 T A 1: 75,133,230 Q131L possibly damaging Het
Slc7a11 A G 3: 50,384,051 V303A probably damaging Het
Slc7a13 T A 4: 19,841,500 V449D probably benign Het
Srp68 A T 11: 116,248,764 I453K probably damaging Het
Steap3 A T 1: 120,234,300 V414D probably damaging Het
Tagln2 A G 1: 172,506,221 N131D probably benign Het
Tmem132d T C 5: 128,269,203 Y85C probably damaging Het
Vcam1 A T 3: 116,115,946 Y577* probably null Het
Vmn1r214 A G 13: 23,035,253 T306A probably benign Het
Zfyve1 A T 12: 83,555,274 probably benign Het
Zgrf1 T A 3: 127,562,041 N305K possibly damaging Het
Other mutations in Safb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01465:Safb APN 17 56602974 unclassified probably benign
IGL02391:Safb APN 17 56600813 splice site probably benign
IGL03145:Safb APN 17 56605287 missense probably damaging 1.00
R0245:Safb UTSW 17 56606025 missense probably damaging 1.00
R0464:Safb UTSW 17 56606025 missense probably damaging 1.00
R0479:Safb UTSW 17 56606025 missense probably damaging 1.00
R0496:Safb UTSW 17 56605630 missense probably benign 0.05
R0639:Safb UTSW 17 56601092 utr 3 prime probably benign
R0655:Safb UTSW 17 56597803 missense probably benign 0.23
R1109:Safb UTSW 17 56601228 splice site probably benign
R1941:Safb UTSW 17 56598992 intron probably benign
R1969:Safb UTSW 17 56605821 missense probably benign 0.32
R1971:Safb UTSW 17 56605821 missense probably benign 0.32
R4010:Safb UTSW 17 56603765 unclassified probably benign
R4132:Safb UTSW 17 56600848 utr 3 prime probably benign
R5429:Safb UTSW 17 56588822 missense probably benign 0.15
R5681:Safb UTSW 17 56599000 intron probably benign
R5900:Safb UTSW 17 56600349 missense unknown
R6077:Safb UTSW 17 56602956 unclassified probably benign
R6173:Safb UTSW 17 56597798 missense probably damaging 1.00
R6367:Safb UTSW 17 56593845 unclassified probably benign
R6735:Safb UTSW 17 56585169 unclassified probably benign
R6736:Safb UTSW 17 56606023 missense possibly damaging 0.46
R7699:Safb UTSW 17 56601504 missense unknown
R7834:Safb UTSW 17 56593881 missense unknown
R7909:Safb UTSW 17 56595665 missense unknown
R8167:Safb UTSW 17 56585286 missense unknown
X0065:Safb UTSW 17 56603798 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGCCAAACTGCCCACTTGGAC -3'
(R):5'- GGCTGATGGTAGAGTGCCACTTTC -3'

Sequencing Primer
(F):5'- GGCCTGGTCACATGATGAAC -3'
(R):5'- TAGGACTTGAAGGTCACGGT -3'
Posted On2013-05-23