Incidental Mutation 'R0468:Kcnn2'
ID41773
Institutional Source Beutler Lab
Gene Symbol Kcnn2
Ensembl Gene ENSMUSG00000054477
Gene Namepotassium intermediate/small conductance calcium-activated channel, subfamily N, member 2
Synonymsfri, SK2, small conductance calcium-activated potassium channel 2, bc
MMRRC Submission 038668-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.162) question?
Stock #R0468 (G1)
Quality Score168
Status Validated
Chromosome18
Chromosomal Location45268860-45686024 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 45559471 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 38 (T38M)
Ref Sequence ENSEMBL: ENSMUSP00000067884 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066890] [ENSMUST00000169783] [ENSMUST00000183850] [ENSMUST00000211323]
Predicted Effect possibly damaging
Transcript: ENSMUST00000066890
AA Change: T38M

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000067884
Gene: ENSMUSG00000054477
AA Change: T38M

DomainStartEndE-ValueType
low complexity region 62 76 N/A INTRINSIC
low complexity region 84 90 N/A INTRINSIC
low complexity region 98 114 N/A INTRINSIC
low complexity region 129 141 N/A INTRINSIC
low complexity region 158 180 N/A INTRINSIC
low complexity region 198 212 N/A INTRINSIC
low complexity region 219 254 N/A INTRINSIC
low complexity region 279 289 N/A INTRINSIC
low complexity region 301 326 N/A INTRINSIC
low complexity region 345 373 N/A INTRINSIC
Pfam:SK_channel 380 493 2.2e-51 PFAM
transmembrane domain 516 535 N/A INTRINSIC
Pfam:Ion_trans_2 572 658 2.2e-14 PFAM
CaMBD 672 748 6.51e-51 SMART
coiled coil region 751 784 N/A INTRINSIC
low complexity region 815 839 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167895
SMART Domains Protein: ENSMUSP00000126285
Gene: ENSMUSG00000054477

DomainStartEndE-ValueType
low complexity region 14 24 N/A INTRINSIC
low complexity region 36 61 N/A INTRINSIC
low complexity region 80 108 N/A INTRINSIC
Pfam:SK_channel 115 233 7e-61 PFAM
transmembrane domain 251 270 N/A INTRINSIC
Pfam:Ion_trans_2 306 394 6.2e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169783
SMART Domains Protein: ENSMUSP00000129659
Gene: ENSMUSG00000054477

DomainStartEndE-ValueType
low complexity region 14 24 N/A INTRINSIC
low complexity region 36 61 N/A INTRINSIC
low complexity region 80 108 N/A INTRINSIC
Pfam:SK_channel 115 215 1.4e-36 PFAM
Pfam:Ion_trans_2 169 254 9.5e-15 PFAM
CaMBD 267 343 6.51e-51 SMART
coiled coil region 346 379 N/A INTRINSIC
low complexity region 410 434 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183850
SMART Domains Protein: ENSMUSP00000139350
Gene: ENSMUSG00000054477

DomainStartEndE-ValueType
low complexity region 62 76 N/A INTRINSIC
low complexity region 84 90 N/A INTRINSIC
low complexity region 98 114 N/A INTRINSIC
low complexity region 129 141 N/A INTRINSIC
low complexity region 158 180 N/A INTRINSIC
low complexity region 198 212 N/A INTRINSIC
low complexity region 219 254 N/A INTRINSIC
low complexity region 279 289 N/A INTRINSIC
low complexity region 301 326 N/A INTRINSIC
low complexity region 345 373 N/A INTRINSIC
Pfam:SK_channel 380 498 2.9e-60 PFAM
transmembrane domain 516 535 N/A INTRINSIC
Pfam:Ion_trans_2 573 659 1.8e-14 PFAM
CaMBD 672 748 6.51e-51 SMART
coiled coil region 751 784 N/A INTRINSIC
low complexity region 815 839 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183897
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184101
Predicted Effect probably benign
Transcript: ENSMUST00000211323
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.2%
Validation Efficiency 100% (61/61)
MGI Phenotype PHENOTYPE: Mice homozygous for a point mutation exhibit tremor and gait abnormalities. Homozygous null mice lack the apamin sensitive component of the medium afterhyperpolarization current but have normal hippocampal morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik A G 12: 71,193,310 H1298R possibly damaging Het
5530400C23Rik T C 6: 133,294,458 L155P probably benign Het
6820408C15Rik A T 2: 152,441,266 R283S probably benign Het
Aldh1l2 T A 10: 83,518,678 E104D probably benign Het
Anxa3 T C 5: 96,811,099 V22A probably benign Het
Bcl7b T C 5: 135,180,883 F188L probably benign Het
Brinp1 T A 4: 68,762,776 I506F probably damaging Het
Bsdc1 T C 4: 129,461,718 probably benign Het
Ccdc180 T C 4: 45,923,271 I1075T possibly damaging Het
Cep162 A G 9: 87,193,697 L1294P probably damaging Het
Cltc G A 11: 86,704,626 probably benign Het
Col11a1 T C 3: 114,217,058 probably benign Het
Col14a1 A T 15: 55,388,646 Y566F unknown Het
Dhx29 A G 13: 112,963,277 Q1148R probably benign Het
Ehbp1 A G 11: 22,169,184 probably benign Het
Ehd3 A G 17: 73,805,379 H46R probably damaging Het
Fam171a1 T C 2: 3,225,396 V522A probably benign Het
Gm4553 C A 7: 142,165,625 C22F unknown Het
Hibadh C T 6: 52,557,770 probably benign Het
Hspg2 G A 4: 137,533,529 C1613Y probably damaging Het
Hydin G T 8: 110,413,223 C708F possibly damaging Het
Ifi208 A T 1: 173,683,481 M401L probably benign Het
Igsf8 G A 1: 172,318,796 V454M probably damaging Het
Irx4 G T 13: 73,266,720 probably benign Het
Kcnh4 C T 11: 100,746,932 G633E probably benign Het
L3mbtl3 C T 10: 26,327,732 R400H unknown Het
Lrp6 T C 6: 134,485,661 T679A possibly damaging Het
Map9 T C 3: 82,374,203 probably null Het
Men1 T A 19: 6,336,923 V5E probably null Het
Mettl14 T C 3: 123,371,412 D93G probably damaging Het
Neb G T 2: 52,211,556 R4601S probably damaging Het
Nell1 A G 7: 50,228,846 T272A probably damaging Het
Olfr1115 A T 2: 87,252,255 N106I probably benign Het
Olfr319 A T 11: 58,701,793 I31F probably damaging Het
Pclo C A 5: 14,677,288 probably benign Het
Pdia5 A G 16: 35,397,507 L502P probably damaging Het
Pkd1l3 C G 8: 109,623,649 D375E possibly damaging Het
Plxna4 C A 6: 32,215,246 C803F probably damaging Het
Pmfbp1 A G 8: 109,513,968 probably null Het
Ptgs1 A G 2: 36,249,193 Y468C probably damaging Het
Pxdn G T 12: 29,994,486 G488W probably damaging Het
Safb C T 17: 56,606,025 R914C probably damaging Het
Sec31b T A 19: 44,518,508 probably benign Het
Shank3 G A 15: 89,549,275 V1333I probably benign Het
Slamf1 A G 1: 171,792,371 probably benign Het
Slc23a3 T A 1: 75,133,230 Q131L possibly damaging Het
Slc7a11 A G 3: 50,384,051 V303A probably damaging Het
Slc7a13 T A 4: 19,841,500 V449D probably benign Het
Srp68 A T 11: 116,248,764 I453K probably damaging Het
Steap3 A T 1: 120,234,300 V414D probably damaging Het
Tagln2 A G 1: 172,506,221 N131D probably benign Het
Tmem132d T C 5: 128,269,203 Y85C probably damaging Het
Vcam1 A T 3: 116,115,946 Y577* probably null Het
Vmn1r214 A G 13: 23,035,253 T306A probably benign Het
Zfyve1 A T 12: 83,555,274 probably benign Het
Zgrf1 T A 3: 127,562,041 N305K possibly damaging Het
Other mutations in Kcnn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Kcnn2 APN 18 45592236 missense probably damaging 0.98
IGL00341:Kcnn2 APN 18 45677071 splice site probably benign
IGL01317:Kcnn2 APN 18 45560627 splice site probably null
IGL02121:Kcnn2 APN 18 45561273 missense probably damaging 0.98
IGL02561:Kcnn2 APN 18 45592192 missense possibly damaging 0.59
IGL03000:Kcnn2 APN 18 45560568 missense probably damaging 0.97
IGL03116:Kcnn2 APN 18 45655206 missense probably damaging 1.00
IGL03155:Kcnn2 APN 18 45685315 missense probably damaging 0.99
IGL03289:Kcnn2 APN 18 45677044 missense probably damaging 1.00
IGL03343:Kcnn2 APN 18 45676959 missense probably damaging 0.97
jitter UTSW 18 45561253 synonymous silent
I2288:Kcnn2 UTSW 18 45675273 intron probably benign
R0256:Kcnn2 UTSW 18 45592405 missense probably damaging 0.98
R0310:Kcnn2 UTSW 18 45560518 missense probably damaging 1.00
R0464:Kcnn2 UTSW 18 45560359 missense probably damaging 0.99
R0485:Kcnn2 UTSW 18 45560148 missense probably benign 0.06
R0722:Kcnn2 UTSW 18 45559476 missense possibly damaging 0.73
R0898:Kcnn2 UTSW 18 45559476 missense possibly damaging 0.73
R1567:Kcnn2 UTSW 18 45670334 splice site probably null
R4543:Kcnn2 UTSW 18 45559648 missense probably benign 0.00
R4720:Kcnn2 UTSW 18 45683120 missense possibly damaging 0.78
R4732:Kcnn2 UTSW 18 45560349 missense possibly damaging 0.94
R4733:Kcnn2 UTSW 18 45560349 missense possibly damaging 0.94
R4801:Kcnn2 UTSW 18 45685267 splice site probably benign
R4844:Kcnn2 UTSW 18 45683120 missense possibly damaging 0.78
R4927:Kcnn2 UTSW 18 45559731 missense probably benign 0.01
R5011:Kcnn2 UTSW 18 45685285 missense possibly damaging 0.86
R5108:Kcnn2 UTSW 18 45592055 missense probably damaging 0.99
R5805:Kcnn2 UTSW 18 45683131 missense probably damaging 0.98
R5841:Kcnn2 UTSW 18 45559396 missense probably benign
R5888:Kcnn2 UTSW 18 45592345 missense probably damaging 0.98
R5926:Kcnn2 UTSW 18 45685284 missense probably benign 0.01
R6552:Kcnn2 UTSW 18 45560098 missense probably benign 0.00
R6882:Kcnn2 UTSW 18 45559438 missense possibly damaging 0.53
R6999:Kcnn2 UTSW 18 45592377 missense probably damaging 0.99
R7324:Kcnn2 UTSW 18 45560071 missense probably benign
R7509:Kcnn2 UTSW 18 45683120 missense probably benign 0.32
R7667:Kcnn2 UTSW 18 45559438 missense possibly damaging 0.53
R8064:Kcnn2 UTSW 18 45559359 start codon destroyed probably benign 0.01
R8122:Kcnn2 UTSW 18 45676938 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCCGCAAACTCAGTCTTGGTCCCT -3'
(R):5'- ACGGCGTCAGCTCGCTCACATT -3'

Sequencing Primer
(F):5'- GGTGATGTCATGCCCATTGTT -3'
(R):5'- CAGGTTATcccccgccc -3'
Posted On2013-05-23